Journal of Medicinal Chemistry (2014), 57(21), 9042-9064

Discovery of Potent and Speci ?c Dihydroisoxazole Inhibitors of Human Transglutaminase 2

Cornelius Klo c k,?Zachary Herrera,?Megan Albertelli,§and Chaitan Khosla *,?,?

Departments of ?Chemistry,?Chemical Engineering and §Comparative Medicine,Stanford University,MC 5080,Stanford California 94305,United States

*

Supporting Information unknown.In the present work,we ?rst pro ?led the (TG1,TG3,and FXIIIa).Signi ?cant cross-reactivity of ?selectivity analyses led to the identi ?cation of pharmacokinetic analysis of the most promising rational selection of dihydroisoxazole inhibitors as The mammalian transglutaminase (TG)family includes nine homologues,eight of which are catalytically competent (TG1?7and Factor XIIIa),whereas one (band 4.2)is devoid of any known catalytic activity.1These enzymes catalyze posttransla-tional modi ?cations of selected glutamine residues on target peptides or proteins,either through the attachment of small molecule or proteinogenic amines leading to the formation of isopeptide bonds or via hydrolysis resulting in a glutamine (Gln)to glutamic acid (Glu)conversion.Mechanistically,both reactions involve a thioester intermediate in which the substrate is attached to a Cys residue in the enzyme active site (Figure 1A).

The spectrum of biological functions of transglutaminases has been extensively reviewed elsewhere.1?4It should be noted that not all of these functions depend upon the ability of these enzymes to modify Gln residues;for example,TG2is also a G protein.5In addition to transcriptional regulation,the activity of TG2(as well as other mammalian transglutaminases)is also exquisitely regulated by various posttranslational cues,including Ca 2+,guanine nucleotides,and intramolecular thiol ?disul ?de interconversion.6

Aberrant transglutaminase activity,most notably in the case of the ubiquitously expressed TG2,has been implicated in the pathogenesis of various human diseases.The role of TG2has arguably been best studied in celiac disease.In celiac disease,TG2catalyzes the site-speci ?c deamidation of gluten peptides,

dramatically increases their immunogenic potential genetically susceptible individuals.7TG2activity has also been implicated in the pathogenesis of Huntington ’s disease,8,9renal ?brosis,10and ischemic reperfusion injury.11,12Last but not least,studies in TG2knockout (TG2?/?)mice suggest a role for TG2in lethality due to endotoxic shock.13Taken together with the fact that TG2?/?mice appear developmentally and reproductively normal,14,15TG2is thought to be an attractive drug target.

A class of widely used TG inhibitors is based on the mildly electrophilic 3-bromo-4,5-dihydroisoxazole (DHI)moiety.Earlier studies by researchers at Syntex Corporation (Palo Alto,CA)16,17as well as our own laboratory 18,19led to the discovery of (S )-quinolin-3-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxy-late (ERW1041E,Figure 1.B),a moderately potent inhibitor of TG2.We have shown that ERW1041E (1)blocks the catalytic activity of TG2in cell culture,20in polyinosinic ?polycytidylic acid (poly(I:C))induced intestinal injury in mice,21and in the hypoxia-induced model of murine pulmonary hypertension.22In the latter study,we also demonstrated that twice-daily,intraperitoneal dosing of this inhibitor at 50mg/kg is well tolerated over the course of several weeks.These studies motivated us to develop an analogue with increased potency

Received:July 27,2014Published:October 21,2014

?2014American Chemical Society

9042

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g

P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

and selectivity.Increased potency would allow us to reduce the dose of the inhibitor,thereby diminishing the risk of o ?-target toxicity,whereas selectivity for TG2over other human transglutaminases is important,as their inhibition could give rise to undesired o ?-target e ?ects.In particular,cross-reactivity with either TG1,TG3,or Factor XIIIa would be most undesirable.The epidermal transglutaminase 1functions in keratinocyte maturation and mutations in its gene give rise to skin barrier dysfunctions.23Plasma Factor XIIIa is activated as part of the blood clotting cascade and is responsible for cross-

linking ?brin to form stable clots.24As such,loss-of-function

mutations in the FXIIIa gene give rise to bleeding disorders in humans.25Recently,mutations in the gene encoding for TG3have been associated with an increased risk of basal cell carcinoma.26To date,little is known about the selectivity of the DHI-based TG2inhibitors.Schaertl and co-workers pro ?led a single compound,quinolin-3-ylmethyl ((S )-1-((((S )-3-bromo-4,5-di-hydroisoxazol-5-yl)methyl)amino)-3-(5-?uoro-1H -indol-3-yl)-1-oxopropan-2-yl)carbamate (ERW1069,Figure 1B)against other transglutaminases and suggested a cross-reactivity with TG1.27However,the IC 50values determined in this report cannot easily be quantitatively interpreted across di ?erent TG isoforms,given that the inhibitors are irreversible and the speci ?city of the substrate had not been characterized.The present study therefore sought to characterize the selectivity pro ?le of existing DHI inhibitors and to systematically improve their selectivity toward TG2.■RESULTS Expression and Puri ?cation of Transglutaminases.As a ?rst step toward pro ?ling our library of inhibitors against various transglutaminases,we prepared recombinant TG1,TG2,TG3,and Factor XIIIa.The expression of human TG2from plasmid pJLP4in Escherichia coli and its puri ?cation by a

sequence of Ni-NTA a ?nity and anion exchange chromatog-

raphy has been described previously and yields 2?3mg of TG2

per liter of culture.28

To produce TG1and TG3,we obtained commercial

expression vectors encoding the full-length genes with N-

terminal His

6tags but were unable to obtain useful quantities of soluble protein from the corresponding strains of E.coli .We

therefore further engineered these expression vectors.In the

case of TG1,the N-terminal domain is reported to function as a

membrane-anchoring sca ?old through posttranslational mod-

i ?cation in eukaryotic cells but is dispensable for catalytic

activity.29,30We therefore prepared a series of N-and C-

terminal truncation mutants.As predicted from previous observations,29a construct with the ?rst 63amino acids deleted and appended with an N-terminal His 6-tag (encoded by plasmid pCK16)yielded 1mg of puri ?ed TG1per liter of culture.The protein had constitutive catalytic activity and did not require posttranslational proteolytic activation.29To produce TG3,the yield of soluble recombinant protein was improved by replacing the N-with a C-terminal His

6-tag in pCK2,resulting in 0.5?1mg of puri ?ed TG3per liter of

culture.This form of TG3is a zymogen and requires proteolytic cleavage in a loop region.Although previous studies had accomplished this using the bacterial protease dispase,31we sought to identify a more plausible physiological candidate for this proteolytic activation step.Cathepsin L has been implicated in this function.32We therefore expressed the human cathepsin

L gene using plasmid pCK7in E.coli .Cathepsin L was produced as inclusion bodies,denatured,and refolded as described previously.33Initial attempts to produce Factor XIIIa (FXIIIa)using plasmid pGF13A234did not yield su ?cient protein for our studies.We therefore replaced the N-terminal glutathione

S-

Figure 1.TG catalytic mechanism and structures of known TG2inhibitors.(A)The active site cysteine of transglutaminases reacts with glutamine

residues acyl donor substrates to form an acyl ?enzyme intermediate that reacts with lysine side chains or small molecule amines to furnish an isopeptide bond.1If water is the acceptor nucleophile,the glutamine donor substrate is e ?ectively hydrolyzed to glutamic acid.(B)Structures of

previously published TG2inhibitors (?gure adapted from the literature 6).

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649043D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i

c

a t i

o

n

D

a t

e

(W

e b

)

:

O

c

t o b

e r

3

1,

20

1

4

|

d o

i

: 1

.1

21

/

j m

5

1

1

4

5

a

transferase fusion partner with an N-terminal His 6-tag.The

resulting plasmid pCK21furnished improved quantities of recombinant FXIIIa that could be activated with commercial bovine thrombin.To produce recombinant murine TG2(mTG2),the gene was synthesized and inserted into an expression 54f171090975f46526d3e14fing the same protocol as for its human orthologue,mTG2was puri ?ed in excellent yield.In Vitro Transglutaminase Assays.With the trans-glutaminase enzymes at hand,we next implemented assays to assess their catalytic activity and to quantify the potency of candidate inhibitors.Previously,we and others have used the glutamate dehydrogenase (GDH)coupled assay for TG2.28,35In this assay,ammonia released by the action of TG2on its glutamine donor substrate is incorporated into α-ketoglutarate by GDH,consuming one equivalent of NADH in the process and allowing spectrophotometric measurement of the reaction rate at 340nm (Figure 2A).Typically,the protected dipeptide CbZ-Gln-Gly (ZQG)is used as a TG2substrate in this setup.We found that this dipeptide was a comparably good substrate for the human and murine forms of TG2(Figure 2B).For the

other transglutaminases,a set of derivatives of this substrate (ZQ-X)were prepared,substituting glycine for other amino acids.Within this set,the serine-containing derivative exhibited the highest turnover at 10mM for TG1and TG3(data not shown)and was therefore chosen as the substrate for these enzymes.FXIIIa did not measurably turn over any of the dipeptide substrates at concentrations up to 100mM.We therefore synthesized and used the peptide,QEQVSPLSLLK,a derivative of α2-antiplasmin that is widely used in commercial diagnostic applications.36Transglutaminase Speci ?city of Known DHI Inhib-itors.We next assembled a library comprising approximately 60TG2inhibitors available in our laboratory from previous published and unpublished studies.18?20,22The entire library or a representative subset was pro ?led against TG1,TG3,FXIIIa,and mTG2.Each compound was assayed at four di ?erent inhibitor concentrations and two di ?erent substrate concen-trations.By ?tting these progress curves to exponential decay functions derived from an irreversible inhibition model,

the

Figure 2.TG assay and substrate speci ?city of TG isoforms.(A)GDH-coupled deamidation assay for translutaminases,where the transglutaminase

(e.g.,

TG2)reacts with a glutamine-donor substrate (e.g.,the dipeptide Z-Q-G)and releases ammonia,which is incorporated into glutamate by the

action of glutamate dehydrogenase.The consumption of NADH in the dehydrogenase-catalyzed reaction is followed spectrophotometrically at 340nm.(B)Michaelis ?Menten analyses and the kinetic parameters of the TG isoforms for their respective substrates.

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649044D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b

l i

c

a t

i

o

n

D

a

t

e

(

W

e

b

)

:

O

c

t o

b

e

r

3

1

,

2

1

4

|

d

o

i

:

1

.

1

2

1

/

j m

5

1

1

4

5

a

inhibition parameter k inh /K i for each compound against each enzyme was estimated.37,38In general,the inhibitors were more

reactive toward TG2compared to either TG3or FXIIIa,as illustrated in the pairwise plots of Figure 3B,C.As anticipated,they were also comparably reactive against the murine orthologue mTG2(Figure 3D).In contrast,a large number of compounds in our library were also potent inhibitors of TG1.The most promising leads had comparable potency against TG1and TG2(Figure 3A).More detailed analysis of the trends in the structure ?activity and ?speci ?city relationships within our library revealed that structures bearing aromatic amino acids or their derivatives were signi ?cantly more potent toward TG1than TG2and that the enzymes shared a preference for tryptophan derivatives over tyrosine or phenylalanine derivatives.Thus,optimization of the aromatic sca ?olds was not deemed to be a productive strategy.In contrast,the proline containing inhibitor ERW1041E had approximately equal reactivity toward TG2and TG1even though

it was a weaker inhibitor of human TG2than the (5-?uoro)-tryptophan containing structures.We therefore chose ERW1041E as a suitable starting point for further optimization.Our working hypothesis was that conformational preorganiza-tion of the proline ring bestowed speci ?city,whereas an aromatic side chain increased potency.Accordingly,a suitable combination of the two features was predicted to yield improvements in potency and speci ?city toward TG2.Design,Synthesis,and in Vitro Analysis of ERW1041E Analogues.Two synthetic routes have been reported thus far for the synthesis of DHI inhibitors;both were used in this study.Traditionally,DHI inhibitors were prepared by introducing the desired carbamate portion of the inhibitor as a nitrophenyl carbonate precursor (e.g.,S4a )into an amino acid methyl ester 11,followed by saponi ?cation to yield acid 12and amide coupling of the DHI moiety,furnishing the ?nal inhibitor 13(route A in Scheme 1).18,19Recently,we reported a convenient multigram synthesis of ERW1041E,where

the

Figure

3.TG isoform speci ?city pro ?le of our library of TG2inhibitors.Pro ?ling the speci ?city of DHI-type transglutaminase inhibitors against individual transglutaminase isoforms furnished inhibition parameter k inh /K i for a number of previously reported inhibitors.The panels depict pairwise plots of these inhibition parameters for TG2versus TG1(A),TG3(B),FXIIIa (C),and mTG2(D).Due to limited availability of active

FXIIIa,only a subset of inhibitors was assayed against this enzyme.

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649045D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b

l

i

c

a

t

i

o

n

D

a

t

e

(

W

e

b

)

:

O

c

t o

b

e

r

3

1

,

2

1

4

|

d

o

i

:

1

.

1

2

1

/

j m

5

1

1

4

5

a

carbamate precursor is an imidazolyl-carbamate S3a (route A *in Scheme 1).22To utilize the abundance of commercially available Boc-protected amino acids 14without the need for onerous protecting group manipulations,we recently inverted this sequence,where the DHI moiety is ?rst coupled to the amino acid,followed by deprotection in neat TFA,furnishing intermediate 15and introduction of the carbamate with either of the previously used precursors S3a or S4a (routes B/B *in Scheme 1).22

Inhibitors bearing substituents at the 4-hydroxy or 4-amino functionality were generally derivatized at the amino acid stage and then carried through the sequence B to assemble the

Scheme 1.Preparation of Inhibitors from Commercial or Synthesized Amino Acid Derivatives with C-Terminal Ester Protection (Route A/A *)or N-Terminal Boc-Protection (Route B/B *)

a

a Routes with an asterisk (A */B *)utilize imidazolyl carbamate building blocks,such as S3a ,routes without (A/B)utilize the traditional nirophenyl

carbonate

building block such as S4a :(a)(S4a ),NMM (3equiv),DMF;(a *)(S3a ),NEt 3(1equiv),DMAP (0.1equiv),DMF/DCM 3:2,

overnight RT;(b)aq LiOH,MeOH/THF;(c)EDCI,HOBt,NMM,(S )-DHI,DMF;(d)TFA;(e)p -nitrophenyl chloroformate,NMM,DCM;(e *)1,1′-

carbonyldiimidazole,ACN,RT.Figure adapted from the literature.22.Scheme 2.Preparation of 4-Aryl Substituted Proline Derivatives

a

a (a)(COCl)2,DMSO,DCM,?78°C,then NEt 3;(b)NaHDMS,Tf 2NPh,THF,?78°C;(c)Pd(PPh 3)4(10mol %),K

2CO 3,dioxane/water;(d)LiOH(aq),MeOH/THF;(e)Rh(PPh 3)3Cl (10mol %),NEt 3,H 2,MeOH/THF;(f)Pd/C (10wt %),NEt 3,MeOH;(g)I 2,KOH,DMF;(h)Boc 2O,DMAP,THF;(i)HBPin,Pd(PPh 3)4(10mol %),NEt 3(10equiv).

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649046D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g

P u

b

l

i

c

a

t

i

o

n

D

a

t

e

(

W

e

b

)

:

O

c t o

b e

r

3

1,

2

1

4

|

d

o

i

:

1

.

1

2

1

/

j m

5

1

1

4

5

a

inhibitor.The 4-amino-proline functionality could also be carried through the synthesis as the Fmoc derivative and deprotected (and subsequently functionalized)after assembly of the inhibitor backbone,although Fmoc deprotection conditions were poorly compatible with the active DHI moiety,resulting in bromide displacement of approximately half of the material.The 4-trans aryl substituted proline derivatives in this study were prepared following a literature procedure employing a Suzuki coupling reaction of a vinyl tri ?ate 17derived from suitably protected L -4-hydroxyproline 16as the key step,furnishing an intermediate ole ?n 18(Scheme 2).39,40While the cis -substituted L -proline 19b derivative was readily obtained by heterogeneous catalytic hydrogenation,the literature precedent for preparation of the trans -diastereomer 19a involves single electron transfer reduction in,e.g.,Li/NH 3.41In contrast to this procedure,we decided to reduce the intermediate ole ?n by a homogeneous hydrogenation,42envisioning that the free carboxylate of the L -proline derivative could serve was a directing group when using Wilkinson ’s catalyst.43Gratifyingly,this procedure furnished the desired trans -substituted 4-aryl prolines in good yields and selectivity when the aryl group was electron rich.For electron poor derivatives,conversion was not complete,especially for the 2-chlorophenyl derivative (data not shown).

Structure ?Activity 54f171090975f46526d3e14fing ERW1041E as the reference compound,we ?rst determined the optimal ring size and relative orientation of the N-and C-terminal appendices (Table 1).Contracting the ring to an azetidine (3a )core mildly reduced TG2activity and retained TG1activity,whereas expansion to the pipecolic acid (3b )decreased TG2activity and speci ?city signi ?cantly.On the ?ve-membered proline sca ?old,moving the carboxamide to the β-position (3c )also reduced TG2while increasing TG1reactivity.In contrast,homo-β-proline (3d )was poorly recognized by either enzyme.The results suggested that proline was the preferred cyclic moiety,both from an overall activity and speci ?city perspective.Next,we sought to explore substituents on this ?ve-membered

Table 1.Activity and Speci ?city of Proline

Derivatives

Table 2.Activity and Speci ?city of Substituted

Prolines

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649047D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g

P u

b

l

i

c

a

t

i

o

n

D

a

t

e

(

W

e

b

)

:

O

c

t o

b

e

r

3

1

,

2

1

4

|

d

o

i

:

1

.

1

2

1

/

j m

5

1

1

4

5

a

ring (Table 2).It is known,for example,that 2-methyl and 4-?uoro substituents impose a conformational bias.44,45While the 2-methyl derivative (4a )was a poor inhibitor of either enzyme,4-cis versus 4-trans -?uoro substitution (4b /4c )had a pronounced e ?ect on the speci ?city,with the cis -diastereomer selectively destabilizing TG1activity.Interestingly,when exploring a set of related inhibitors with hydroxyl groups at the 3-or 4-position (see Table S1in the Supporting Information),we found the 4-trans -hydroxy-derivatives S1d or 4e to possess the highest activity and speci ?city for TG2,possibly delineating opposing e ?ects of ring conformation versus steric demand.The 4-trans -hydroxy-group presented a functional handle for further elaboration of DHI inhibitors (Table 2).Derivatizing the hydroxyl-group into methyl (5a ),propargyl (5b ),and benzyl (5c )ethers was well tolerated but o ?ered little to either speci ?city or potency.Having established that bulky aromatic substituents were tolerated,we moved the aromatic ring closer to the proline core.Surprisingly,whereas 4-benzyl-proline (6)signi ?cantly elevated TG1reactivity with little e ?ect on TG2potency,4-phenyl proline (7a )signi ?cantly increased TG2activity albeit raising TG1reactivity concomitantly.Introducing a 4-trans -amino functionality (4e )and thus a positive charge yielded a poor inhibitor itself but o ?ered additional functionalization options.For example,the benzamido derivative 9a had good TG2potency,albeit again increased TG1reactivity.Guided by our hypothesis that both potency and speci ?city may be improved by combining conformational preorganiza-tion with aromatic side chains,we explored the 4-aryl and the 4-arylamido series further (Table 3).In the 4-aryl series,we ?rst veri ?ed that 4-trans was indeed the preferred con ?guration.Both the 4-cis derivative 7b as well as a planar ole ?n derivative 8had diminished potency.We next introduced hydroxy (7c ?e )and chloro substituents (7f /g )on the aromatic ring and found that the phenolic compounds were preferable,both with respect to potency and 54f171090975f46526d3e14fpound 7e was particularly promising.Given that earlier studies had shown that tryptophan was the ideal aromatic amino acid and the 5-?uoro substituted derivative a particularly potent inhibitor,19we

Table 3.Activity and Speci ?city of 4-Aryl Substituted

Prolines

Table 4.Activity and Speci ?city of 4-Amido Substituted

Prolines

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649048D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g

P u

b

l

i

c

a

t

i

o

n

D

a

t

e

(

W

e

b

)

:

O

c

t o

b

e

r

3

1

,

2

1

4

|

d

o

i

:

1

0.

1

2

1

/

j m

5

1

1

4

5

a

also prepared the 3-(5-?uoro)-indolyl compound 7h ;however,this modi ?cation poorly translated from the open chain amino acid to the proline-derived series.

Starting from the 4-benzamido prolyl inhibitor 9a ,we investigated a hydroxyl-substituted series of analogues (9b ?d ,Table 4).An analogous trend to the 4-aryl series was observed where the p -hydroxy substituent was optimal,furnishing a potent TG2inhibitor with modest speci ?city versus TG1.Moving from the parent phenyl ring to heteroaromatics,we saw a dramatic increase in potency and speci ?city in the nicotinamido-derivative 9e .Adding a second nitrogen atom in the ring with the pyrazyl-derivative 9f yielded a precipitous drop in potency.Given that the change from pyridine to pyrazine or phenyl is accompanied by a signi ?cant decrease or absence of hydrogen bond accepting capacity,we speculated that the 3-pyridyl group allows a new hydrogen bond to be established.This was consistent with the observation that an aspartate derivative in our initial library was fairly speci ?c,albeit not potent (data not shown).We further hypothesized that the presence of Lys176proximal to the active site in the open crystal structure of TG2(PDB 2Q3Z),46but not in a homology model of TG1,6was the source of this hydrogen bonding capacity.However,when the negatively charged derivative 9g was synthesized and evaluated,it was as potent as 9e .

All new inhibitors presented in this study had the 3-methylquinolinyl carbamoyl substituent,which was determined

to be the best within a limited set of variants in a previous study.19On the basis of our library screening e ?orts,we had anticipated that the contributions of the amino acid and carbamate portions were not independent (data not shown).Given that the carbamoyl substituent had previously been optimized on a tyrosine backbone,19we sought to explore the structure ?activity relationship of this position in the context of the proline core.

A number of analogues were prepared by replacing the carbamate with an amide,but none of these compounds could increase the potency or speci ?city of the resulting inhibitors (see Table S2in the Supporting Information).Thus,we explored variations of the parent carbamate motif (Table 5).Whereas propargyl carbamate (10b )was 3-fold selective for TG2over TG1,it was a poor inhibitor.Other simple carbamates,such as t -butyl (10a )or benzyl carbamate (10c ),furnished inhibitors with modest potency and no speci ?city advantage.Introducing substituents on the benzyl group,such as 3-?uoro (10d ),the previously published “clickable ”4-ethynyl group (10e ),or methoxy-groups (10f )also did not signi ?cantly improve these parameters.We next tested whether the ?exible positioning of additional aromatic bulk would better ?ll the hydrophobic pocket observed in the crystal structure,46but compound 10g was a poor inhibitor of TG2.Replacing benzyl by pyridyl revealed a preference of TG2for 3-pyridyl over the isomers with a 2-or 4-substitution (10h ?j ),but

Table 5.Activity and Speci ?city of Carbamate

Derivatives

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9049

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

neither potency nor selectivity was improved.As observed previously,moving to 3-quinolyl increased the potency for TG2about 4-fold,whereas 4-quinolyl (10k )dramatically disfavored binding to TG2but not TG1.Introducing an additional nitrogen atom in the heteroaromatic system in the form of a 2-quinoxalyl (10l )led to a precipitous drop in activity against TG2and an inhibitor that was 10-fold more selective for TG1.This observation led us to explore the hypothesis that a hydrogen bond to the quinoline nitrogen was important for binding to TG2but not TG1.Accordingly,we replaced quinoline with the much stronger hydrogen bond accepting 2-benzimidazole (10p )or N -methyl-2-benzimidazole (10q ),but these changes abrogated both TG1and TG2inhibition.Finally,we introduced methyl substituents on the carbamate methylene with the goal of increasing conformational preorganization.On the naphthyl backbone,the S isomer 10m was preferred by both TG1and TG2over its R diastereomer 10n ;however,this modi ?cation did not yield a tangible bene ?t when translated to the quinolyl moiety (10o ).In summary,we determined that signi ?cant changes in potency and speci ?city can be achieved by varying the (hetero)aromatic group in the carbamate moiety,but that none of these were productive toward the goal of this study.Selectivity and Pharmacokinetic Pro ?ling of the Most

Promising Inhibitors.To identify compounds that could be

useful for in vivo biological studies,we conducted further

selectivity and pharmacokinetic analysis on the most promising compounds from this study.Speci ?cally,a set of eight compounds was selected based on their potency against TG2,selectivity for TG2over TG1,and chemical diversity.First,their selectivity against a broader range of transglutaminase isozymes was pro ?led (Table 6).From this analysis,inhibitor 9e (also designated as CK996)emerged as the most potent and selective inhibitor of human TG2,although compounds 7a (also designated as CK805)and 7e (also designated as CK937)may arguably be more e ?ective in mouse studies.From prior experience with this class of compounds,we anticipated short half-lives (t 1/2<15min in mice)for all of our

selected compounds.We therefore sought to estimate in a

resource e ?cient manner which of these compounds had appreciable oral bioavailability.To do so,we pooled the compounds in two groups of four each,where individual members would not overlap in their masses and adducts in mass spectrometry.We then administered the compound mixtures to mice in a dose of 50mg/kg for each constituent member by the oral route.

Table 6.Activity and Speci ?city of Promising Lead

Compounds Figure 4.Plasma concentrations of TG inhibitors after oral dosing.Following oral administration of sets of TG inhibitors to mice at 50mg/kg,blood

was

sampled at 5,20,and 60min time points.The concentration of each compound in plasma was quanti ?ed,and the resulting pro ?les plotted as

time versus concentration curves,as depicted.Whereas some inhibitors,such as CK996and CK999,have negligible systemic availability,others,such as ERW1041E and ZH147A,reach peak concentrations of 2?3μg/mL.

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649050D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b

l

i c

a

t

i

o

n

D

a t

e

(W

e b

)

:

O

c

t o

b

e

r

3

1

,

2

1

4

|

d

o

i

:

1

.

1

2

1

/

j m

5

1

1

4

5

a

All compounds were rapidly cleared from circulation (Figure 4).Relative to their plasma concentrations at 20min,the equivalent values at 60min were at least 4-fold lower,verifying that their half-lives were shorter than 20min.No compound appeared to possess a considerably longer half-life than the others;as such,this parameter did not provide any basis for the selection of a speci ?c lead compound.Knowing that this class of compounds achieves high peak concentrations in plasma after intraperitoneal administration (ca.20?40μg/mL,data not shown),we sought to establish if any compound could achieve at least 10%of this value range after oral 54f171090975f46526d3e14fpound 4b (aka ZH147A),harboring the 4-cis ?uoro moiety,was most promising in this regard,with plasma concentrations of 2.9±1.5and 2.1±1.1μg/mL at 5and 20min,respectively.The unsubstituted parent ERW1041E (1)also had reasonable oral bioavailability,achieving plasma concentrations of 2.1±1.1and 1.2±0.6μg/mL at 5and 20min,respectively.The plasma levels of the more potent derivatives with a 4-aryl moiety (7a /e )(aka CK805/CK937)were 3?4-fold lower than that of 4b ,whereas the 4-arylamido derivatives (9d /e )were much less bioavailable,suggesting that these compounds are either inherently impermeable or that they undergo more rapid presystemic metabolism (possibly even in the intestinal lumen).In summary,on the basis of all of the above measurements,we propose three improved analogues of ERW1041E for consideration in advanced tissue culture or animal models of diseases where TG2is believed to play a pathogenic 54f171090975f46526d3e14fpound 9e (aka CK996)is the most potent and speci ?c inhibitor of human TG2and is therefore ideally suited for studies in which isoform selectivity is of paramount importance.Inhibitor 4b (aka ZH147A)has lower potency but superior oral bioavailability and is arguably most appropriate for “topical ”applications such as celiac disease,where TG2-mediated in ?ammation is thought to be localized to the small intestine and its associated mesenteric lymph nodes.47Inhibitor 7a (aka CK805)combines all of these properties,albeit at an intermediate level,and is therefore also worthy of further consideration.■DISCUSSION AND CONCLUSIONS The structure ?activity relationships of DHI inhibitors of mammalian transglutaminases have been the subject of four reports over the past 25years.17?20Prior to this study,these e ?orts had led to the discovery of benzyl ((S )-1-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)amino)-3-(4-hydroxy-phenyl)-1-oxopropan-2-yl)carbamate KCC009,a prototypical nonspeci ?c inhibitor,and ERW1041E,an inhibitor with moderately higher potency.Both compounds have found widespread utility as tools to study the physiological role of TG2and have aided in de ?ning its role in the pathogenesis of various human diseases.22,48?51Our own studies with these tool compounds in animals have highlighted the excellent tolerability of small molecules harboring this weakly electro-philic glutamine isostere and have motivated the development of medicinally useful lead compounds described in this report.In de ?ning the characteristics of a su ?ciently improved compound relative to ERW1041E,we identi ?ed potency,selectivity,and pharmacokinetic pro ?le as aspects that warranted attention.The potency of ERW1041E against human TG2is moderate (k inh /K i =17mM ?1min ?1).It has comparable activity against human TG1(k inh /K i =13mM ?1

min ?1).Although it has been successfully used in an intraperitoneal form in studies on a rodent model of pulmonary hypertension,22its dose ?response characteristics were not explored nor have its pharmacokinetic properties been characterized.As a ?rst step,we sought to pro ?le the potency and speci ?city of each member within our existing compound library of DHI inhibitors.It rapidly became apparent that,while the DHI inhibitors had little cross-reactivity against TG3and FXIIIa,they had strong reactivity toward TG1.This observation might have been anticipated,given that the DHI-based inhibitors were initially developed as TG1inhibitors.16,17However,we were surprised by the extent of cross-reactivity and speculate that it is due to an inherently higher reactivity of

the TG1active site.SAR analysis revealed that aromatic amino acids had high speci ?city for TG1,whereas the proline-containing inhibitor ERW1041E had the most desirable isoform

speci ?city,being approximately equipotent between TG1and TG2.This improved speci ?city,however,was accompanied by a 3?4-fold decrease in potency from ERW1069to ERW1041E.We therefore systematically explored cyclic systems,hypothesizing that it may be possible to combine the speci ?city of a cyclic or conformationally preorganized inhibitor with the gain in potency of inhibitors with aromatic moieties.Proline was the optimal cyclic system,with substitutions at the 4-position being most bene ?cial for selectivity and potency.Interestingly,the preferred stereochemistry for a ?uoro-substituent was cis ,whereas hydroxy-and larger moieties needed to be attached in the trans -orientation,possibly delineating opposing conformational and steric e ?ects.In fact,in the 4-trans -orientation,relatively large hydrophobic sub-stituents were tolerated when attached rigidly o ?the proline ring,either directly or via an amide-bond linkage.Some of these modi ?cations dramatically increased the potency of our inhibitors against TG2.Exploring the ideal nature of the aromatic group,we found that p -hydroxy-substitutions were bene ?cial and,in the arylamide series,attaching nicotinamide increased the selectivity for human TG2over TG1.With a number of improved DHI inhibitors at hand,we also sought to pro ?le the pharmacokinetic properties of a

representative set of compounds.Whereas all compounds had comparable and short systemic half-lives on the order of 10?15

min,there were marked di ?erences in their oral bioavailability.

For reasons outlined above,three compounds,CK996,ZH147A,and CK805,are recommended for further biological evaluation as improvements over the most widely used reference compound of this series,ERW1041E.Their pharmacokinetic pro ?le suggests that one potential area for further biological evaluation is celiac disease.In celiac disease,the pathogenic TG2activity resides in the gut.A topical agent with low and short systemic exposure might be an appropriate lead for this indication.

In conclusion,we also note that the compounds in this study contain the mildly electrophilic DHI moiety that covalently inactivates TG2.The use of an irreversible inhibition strategy and the presence of even mild electrophiles in medicinal leads has been subject to some controversy due to concerns regarding nonspeci ?c reactivity,haptenization of self-proteins,and the resulting toxicity of these chemotypes.52,53In recent years,however,covalent inhibitors have received renewed interest in the form of “targeted covalent inhibition ”(TCI).54A number of drugs exploiting this strategy have been approved or are currently undergoing clinical trials (such as Afatinib or Neratinib).55At the heart of a TCI-based strategy lies a mildly electrophilic functional group that is incorporated into an

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649051D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u

b l

i

c

a t

i

o n

D a

t

e

(

W e

b

):

O

c t o

b e

r

31

,

20

14

|

d o

i

:

1

.1

21

/

j m

5

01

14

5

a

inhibitor sca ?old,which itself has a ?nity to a speci ?c binding site and drives the covalent modi ?cation of a speci ?c nucleophile in this site through proximity and suitable positioning of the reactive partners rather than blunt reactivity.A widely used reactive moiety is acrylamide.54We propose that the 3-bromo-4,5-dihydroisoxazole (DHI)moiety can be a valuable functional group in targeted covalent inhibitors for transglutaminases.The warhead is stable in the presence of millimolar concentrations of glutathione at physiological or above physiological pH and is thus not broadly thiol-reactive.18A detailed analysis of the inhibition kinetics also reveals that the rate constant for covalent inactivation k inh is frequently less than 0.1min ?1,underscoring the importance of noncovalent molecular recognition in enzyme inhibition.This is further validated by our observation that lead compounds can be engineered to quite high speci ?city against closely related proteins,including TG3and FXIIIa.Perhaps most pertinently,employing a TCI strategy for TG2appears particularly attractive in light of our current understanding of the pharmacodynamics of the target.In a murine model of hypoxia-induced pulmonary hypertension,we observed that the inhibitory half-life of ERW1041E was about 12h 22and such slow (re)activation kinetics seem very amenable to covalent inhibition,where a short period of an inhibitor present drives e ?cacy for many hours and might thus translate to fewer o ?-target e ?ects of any chemical matter administered.

■

EXPERIMENTAL SECTION

Protein Expression.General Protein Expression Protocol.All transglutaminases used in this study were expressed in E.coli ,using standard conditions,similar to the previously published protocol for transglutaminase 2.28Brie ?y,the respective expression vector was inserted into E.coli Rosetta 2pLysS strain by electroporation.Cell stocks were prepared by picking individual colonies,growing them in liquid LB Miller broth with 33mg/L chloramphenicol and 50mg/L kanamycin at 37°C overnight,and freezing aliquots with 20%glycerol at ?80°C until use.Starter cultures of the same LB broth were inoculated with the cell stocks,grown to high cell density at 37°C overnight,and used to inoculate production cultures in 2L ba ?ed shake ?asks.The production cultures were grown until an OD 600of 0.5?0.6was reached and then transferred to refrigerated shakers at 18°C.Protein expression from the T7promoter was induced by the addition of 200μM IPTG,and shaking continued overnight (usually 12?18h).Cells were then harvested by centrifugation at 4420g at 4°C and the pellet was either directly used in the extraction and puri ?cation steps (vide infra)or ?ash frozen in liquid nitrogen and stored at ?80°C until workup.

All puri ?cation steps were carried out on ice or in a temperature-controlled room at 4°C.The pellets were suspended in lysis bu ?er (50mM phosphate bu ?er at pH 7.6with 300mM sodium chloride,20mM imidazole and 20%glycerol),typically using about 25mL of bu ?er per liter of production culture.Cells were lysed by sonication on ice (5?8cycles,each 40?60s long).The lysate was cleared by centrifugation at 25,000g for 45?60min at 4°C and then an initial puri ?cation carried out by a ?nity chromatography.The cleared lysate was thus incubated with Ni-NTA resin for 30?40min and the resin ?ltered and washed with at least 10column volumes of lysis bu ?er.The immobilized proteins were then eluted from the Ni-NTA resin using 20?25mL of elution bu ?er (50mM phosphate bu ?er at pH 7.6with 100mM sodium chloride,150mM imidazole,and 20%glycerol).The eluate was diluted to 50mL with water and then applied to an anion exchange column (HiTrap Q)on an FPLC system.The transglutaminases were eluted with a gradient of sodium chloride in 20mM Tris bu ?er at pH 7.8with 1mM EDTA and 1mM DTT.The elution was monitored by UV absorbance,fractions of interest were analyzed by SDS-PAGE,and those containing the desired protein

pooled,concentrated,or bu ?er exchanged on Centricon centrifugal ?ltration devices.

Human Transglutaminase 1(TG1).A complete expression vector with codon-optimized human transglutaminase 1(NM_000359)with an N-terminal His 6-tag in the pQE-T7expression vector was purchased from Qiagen.A truncated form of this gene,encoding for amino acids 63?817appended with an N-terminal His 6-tag (MHHHHHHGSG ?)was PCR ampli ?ed using the primers AAAAAACATATGCACCATCACCATCACCATGGTAGTGG-TCCGGAACCGAGCGATAGCCG and GTGGTGCTCGAGTCT-TACTA.The amplimer was restriction digested with NdeI and XhoI and ligated into the pQE-T7vector to obtain expression plasmid pCK16.This plasmid was introduced into the E.coli Rosetta 2pLysS strain,and TG1protein was expressed and puri ?ed as described in the general procedure.TG1eluted from the anion-exchange column at about 230mM sodium chloride in a yield of about 1mg per liter of initial culture.The puri ?ed protein was concentrated to 4?6mg/mL in 20mM Tris bu ?er at pH 7.8with 150mM sodium chloride,1mM EDTA,1mM DTT,and 20%glycerol and stored at ?80°C.

Human Transglutaminase 2(TG2).Human transglutaminase 2was expressed from plasmid pJLP4,28which encodes for the V224G variant,56in the E.coli Rosetta 2strain and puri ?ed using the general procedure outlined above.Puri ?ed TG2was concentrated to 4?5mg/mL in 20mM Tris bu ?er at pH 7.8with 150mM sodium chloride,1mM EDTA,1mM DTT,and 20%glycerol and stored at ?80°C.Human Transglutaminase 3(TG3).A complete expression vector with codon-optimized human transglutaminase 3(NM_003245)with an N-terminal His 6-tag in the pQE-T7expression vector was purchased from Qiagen Inc.To obtain the C-terminally His 6-tagged (?LEHHHHHH)variant,TGM3was PCR ampli ?ed using primers AAAAAACATATGGCAGCACTGGGTGTTCAGAG and TTTTTTCTCGAGTTCT-GCAACATCAATGCTCA.The am-plimer was then inserted between the NdeI and the XhoI sites of the parent pQE-T7vector,a ?ording plasmid pCK2,and correct ligation was con ?rmed by sequencing from the T7promoter and the T7terminator sites.pCK2was introduced into the E.coli Rosetta 2pLysS strain as above and TG3expressed and puri ?ed using the general procedure,furnishing about 0.6?1.0mg per liter of production culture.Because TG3eluted from the anion exchange column at relatively low ionic strength (approximately 160mM sodium chloride),the Ni-NTA elution bu ?er contained no added sodium chloride and only a small volume (approximately 15mL)of bu ?er was used to allow for a greater dilution with water prior to loading the FPLC system.The puri ?ed protein could be concentrated to approximately 4mg/mL,but 20%glycerol had to be added prior to this step to avoid precipitation at concentrations greater than 1mg/mL.

Human Factor XIIIa (FXIIIa).The pGF13A2plasmid,harboring full length human FXIIIa as an N-terminal GST fusion,originally constructed and published by Greenberg and co-workers 34was obtained as a gift from Dr.Je ?rey Keillor (University of Ottawa).To generate an N-terminal His 6-tagged (MGHHHHHHGSG ?)version of FXIIIa,the gene was PCR ampli ?ed from the pGF13A2vector using primers AAAAAACCATGGGTCATCACCATCAC-CATCACGGTAGTGGTATGGCAGAAACTTCCAGGAC and TTTTTTCTCGAGTCACATGGAAGGTCGTCTTT,the amplimer was restriction digested and ?nally ligated between the NcoI and XhoI sites of the pET28a(+)vector,furnishing the plasmid pCK21.Correct insertion was con ?rmed by sequencing the plasmid was then introduced into the E.coli Rosetta 2pLysS strain.Deviating from the general procedure,production cultures of this strain were grown in Terri ?c Broth.Cells were induced,harvested,and lysed as described above,and the protein puri ?cation followed the general procedure.However,it was found crucial that all bu ?ers including the solvents used in the FPLC puri ?cation contain 20%glycerol to aid protein stability.34Similar to TG3,the elution bu ?er from the Ni-NTA resin contained no added sodium chloride.During anion-exchange chromatography,Factor XIIIa eluted at approximately 150mM sodium chloride in about 1mg overall yield per liter of production

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9052

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

culture.The puri ?ed protein was concentrated to 2mg/mL and stored at ?80°C.

Murine Transglutaminase 2(mTG2).An expression vector harboring codon-optimized murine TG2(NM_009373)with a double N-terminal His 6-tag (MGSSHHHHHHSSGLVPRGSHMG-HHHHHHLVPRGS ?)was obtained as a gift from Dr.Bana Jabri (University of Chicago).The plasmid was introduced into the E.coli Rosetta 2pLysS strain as described above.Murine TG2was expressed from this strain and puri ?ed using the conditions of human TG2furnishing approximately 10mg per liter of production culture.

Human Cathepsin L.A cDNA clone containing full length human procathepsin L (NM_001912)was obtained from Open Biosystems.The gene was ampli ?ed via PCR using primers AAAAAAGC-TAGCGCCATGGGCACTCTAACATTTGATCACAG and TTTTTTCTCGAGTCACACAGTGGGGTAGCTGG,restriction di-gested,and ligated between the NcoI and XhoI sites of the pET28a(+)vector,furnishing plasmid pCK7.

Because it was known that recombinant procathepsin L is expressed as inclusion bodies,we used the following protocol to obtain the puri ?ed active enzymes.When the production culture of E.coli Rosetta 2pLysS had reached OD 600=0.6,we induced expression from the T7promoter with 1mM IPTG and kept the cells shaking at 37°C for another 5h.The cells from 2.4L of culture were harvested by centrifugation and disrupted by sonication in 50mL of lysis bu ?er (100mM Tris,pH 8.0,1mM EDTA)and the lysate cleared by centrifugation as described.The supernatant from this step was discarded,and the pellet with the insoluble inclusion bodies was resuspended in 36mL of lysis bu ?er with 1%Triton X-100followed by centrifugation and removal of the supernatant.After a second cycle of washing,1.2g of washed inclusion bodies were obtained from 2.4L of production culture.

Procathepsin L was solubilized and refolded following a literature procedure.33,57Brie ?y,the inclusion bodies were dissolved to 100mg/mL in 50mM sodium acetate bu ?er at pH 4.5with 6M guanidinium hydrochloride,1mM EDTA,and 100mM DTT,and the solution was stored at ?80°C until use.For a small scale refolding setup,100μL of denatured procathepsin L was slowly added to a 10mL aliquot of refolding bu ?er (192mM Tris at pH 8.2with 7.4mM oxidized glutathione,8.35mM reduced glutathione,400mM MgCl 2,and 0.07%Brij-35)with vigorous stirring.After 3h,the cloudy mixture was clari ?ed by passing through a 0.2μM syringe ?lter,and aqueous 1M citric acid to a pH of 3?4was added to activate the proenzyme.After 30min,20%glycerol was added.The refolded and activated cathepsin L was concentrated in a Centricon centrifugal ?lter to 1mg/mL and stored in aliquots at ?20°C.

In Vitro Activity Assays.TG Assays.The activity of trans-glutaminases was measured via the glutamate dehydrogenase (GDH)coupled assay 28,35using an assay bu ?er of 200mM MOPS,pH 7.2,5mM CaCl 2,10mM α-ketoglutarate,with 300μM NADH,36U/mL bovine GDH,and the respective substrates (ZQG for TG2and mTG2,ZQS for TG1and TG3,and QEQVSPLSLLK for Factor XIIIa).TG1,TG2,and murine TG2were directly diluted from the enzyme stock to typical ?nal concentrations of 0.37,0.34,and 0.22μM,respectively.For TG3,an aliquot of the enzyme was diluted with 1.5volumes of 50mM MES bu ?er at pH 6.0and an appropriate volume of cathepsin L (1μg per 25μg of TG3)added.The cleavage reaction was allowed to proceed for 30min,whereafter 50μM of the irreversible cathepsin L inhibitor E64was added (1:200from 10mM DMSO stock)and allowed to react for 10min before the activation mixture was diluted into the assay mixture to a typical TG3concentration of 0.43μM.For Factor XIIIa,commercial bovine thrombin was dissolved to 1U/μL in 1×thrombin dilution/storage bu ?er from a commercial thrombin cleavage kit (Novagen,speci ?ed as 50mM citrate bu ?er at pH 6.5,200mM sodium chloride,1mg/mL PEG-8000,and 50%glycerol).To an aliquot of FXIIIa was added an appropriate volume of 10×cleavage bu ?er from the same kit (speci ?ed as 200mM Tris bu ?er at pH 8.4,1.5M sodium chloride,25mM CaCl 2),followed by thrombin (1U per 80μg).The cleavage was allowed to proceed for 30min at room temperature,and the enzyme mixture was diluted into the assay mixture to about 0.092μM.Transglutaminase inhibitors were

dissolved in DMSO,and the ?nal DMSO content was typically 1%(v/v)in the ?nal assay bu ?er.To allow for accurate dispensing,inhibitors were usually prediluted in a larger volume of assay bu ?er.Whenever possible,large volumes of premixes were used to decrease assay variability.In assay formats where full progress curves of irreversible inhibitors were to be recorded,the enzymes were allowed to equilibrate and turn over in the ?nal assay bu ?er for at least 5min (30min for TG3)before any inhibitors were added.The progress of the enzymatic reaction was followed colorimetrically at 340nm in either a quartz cuvette in a UV spectrophotometer or in UV compatible half area microplates in an absorbance plate reader.In the latter,the data was corrected for the volume-dependent path length (typically d =150μL/170μL).To determine the substrate speci ?city,the assay was conducted with variable concentrations of substrate and the data ?t to the Michaelis ?Menten equation (Figure 2).For irreversible inhibitors,individual progress curves were ?t to exponential decay functions (and corrected for background non-linearity as for FXIIIa)and the parameters k inh /K i obtained from an irreversible inhibition model,as described before.18,28R 2values were typically higher than 0.9(and almost invariably >0.8)for individual ?ts.To assess the reproducibility of these measurements,the k inh /K i values for a number of inhibitors (including ERW1041E,CK996,ZH147A,and CK805)were measured via multiple independent experiments.In all such cases,interexperimental variation below 25%was observed.

Library Pro ?ling.To assemble the library of existing TG2inhibitors,we freshly dissolved solid compound stock (where available)in DMSO to a 10mM concentration and stored aliquots at ?20°C until use.To obtain enough data points for ?tting to an irreversible inhibition model,we assayed each inhibitor at four di ?erent concentrations (typically 100/33.3/11.1/3.7μM)in the presence of two di ?erent substrate concentrations (typically 10/20mM ZQG for TG2and mTG2,20/40mM ZQS for TG1and TG3,and 0.5/1.5mM QEQVSPLSLLK for FXIIIa).

For a medium throughput assay method,we plated the compounds in 384-well plates and prepared a 4-point 1:2dilution series in DMSO as a 100×concentrated stock.We next plated 245μL of 1×assay bu ?er into four rows of a 96-well plate and,shortly before commencing the assay,added 7.5μL of each DMSO dilution stock to obtain enough 3×concentrated inhibitor ?master mix for two 96-well plates to be run simultaneously.We then prepared 6mL of a 1.5×concentrated enzyme ?substrate master mix for each substrate concentration and let the mixture equilibrate for 5?10min (30min for TG3).To each well in a UV-compatible 96-well plate,we added 50μL of an inhibitor ?master mix and started the assay by adding 100μL of the pre-equilibrated enzyme ?master mix and immediately began data acquisition at 340nm in an absorbance plate reader (3reads/min with 3s shaking in between reads).The full progress curves were analyzed and inhibition parameters computed as described above,using an automation routine implemented in STATA.

In Vivo Pharmacokinetics.Formulation.To rapidly pro ?le the pharmacokinetic properties of the novel TG2inhibitors from this study,eight inhibitors were pooled into two dosing groups,A (compounds 4e ,5c ,7a ,and 9d )and B (compounds 1,4b ,7e ,and 9e ),containing identical amounts of each inhibitor (by mass).For oral delivery,the inhibitors were formulated by dissolving the mixtures to 25mg/mL (concentration of each compound)in 1M hydrochloric acid with 10%Tween-80and 25%absolute ethanol under vortexing and sonication.This solution was rapidly diluted 5-fold into a bu ?er with 0.94%methylcellulose suspended in 250mM aqueous trisodium citrate,resulting in a milky suspension that was used within 2h of preparation and shaken repeatedly to avoid aggregation and precipitation of the very ?ne suspended particles.

Dosing and Sample 54f171090975f46526d3e14fing the inhibitors formulated as above,cohorts of ?ve male CD-1mice (6?8weeks of age)were fasted for approximately 6h and then each dosed by oral gavage (10μL/g),equivalent to a dose of 50mg/kg of each individual inhibitor.Blood was collected in lithium-heparin tubes by sampling from the saphenous vein at 5and 20min postdosing and by cardiac puncture at 60min post dosing after the mice had been euthanized in a CO 2chamber.

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9053

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

Sample Workup.Plasma was obtained from whole blood by sedimenting the cells for 20min in a benchtop microcentrifuge and removing the supernatant liquid.The plasma was stored at ?20°C until analysis.For analysis,the plasma samples were thawed on ice,and 25μL (group A)or 10μL (group B and standard curve)were withdrawn.To each sample,an equal volume of internal standard (IS)spiking solution (1μM 5b in 95%water,4.9%acetonitrile,and 0.1%DMSO)was added,followed by an equal volume of blank spiking solution (95%water,4.9%acetonitrile,and 0.1%DMSO).To generate standard curves,blank plasma was taken and an equal volume of IS spiking solution added,followed by an equal volume of compound spiking solution (24.4ng/mL to 12.5μg/mL per compound,separated in the same groups,in 95%water,4.9%acetonitrile,and 0.1%DMSO).The volumes of all samples were increased to 250μL by the addition of water and well mixed.Then,600μL of ethyl acetate were added and the samples thoroughly shaken and vortexed.The phases were separated by brief centrifugation,and then 500μL of ethyl acetate were withdrawn to a microcentrifuge tube,300μL of new ethyl acetate added,and the extraction repeated.Another 300μL were then withdrawn,and the combined extracts were evaporated.To reconstitute the residues,20μL of methanol were added to each tube and thoroughly vortexed.After brief centrifugation,80μL of water with 0.1%formic acid were added and the tubes thoroughly vortexed again.The liquids were withdrawn,passed through 0.45μm centrifugal ?lter units,and analyzed by LC-MS (ESI-QTOF).

Analysis.Total ion chromatograms were extracted for the most prevalent masses of each compound ([M +H]+and its 81Br isotopologues,except for compound 9e ,where [M +2H]2+and its isotopologue was used)and the peaks integrated.The peak areas of analytes were normalized by the peak area of the internal standard.Standard curves were used to calculate the concentration of analytes in the plasma samples (see Figure S1in the Supporting Information).Synthesis.General Procedure for the Preparation of TG2Inhibitors.The inhibitors were prepared analogously to the method reported in the literature and puri ?ed to ≥95%as judged by the HPLC chromatogram obtained on an ESI-QTOF LC-MS.22Step 1.The Boc-protected amino acid 14(1equiv),EDCI HCl (1.15equiv),HOBt hydrate (1equiv),and (S )-(3-bromo-4,5-dihydroisoxazol-5-yl)methanamine ((S )-DHI,1equiv),prepared by our modi ?cation 22of the procedure of Rohlo ?and co-workers,58were dissolved in DMF (to approximately 150mM)and N -methylmorpho-line (2equiv)was added.The mixture was stirred for 30min but can also be left stirring overnight and then diluted with approximately 10volumes of water and extracted with 10volumes of ethyl acetate.The organic layer was washed with 10volumes of sodium bicarbonate twice,followed by 10volumes of brine,dried over sodium sulfate,and evaporated.The product was typically obtained as a viscous oil.Step 2.The crude product was taken up in tri ?uoroacetic acid (to approximately 170mM)and stirred for 30min before the acid was carefully evaporated.The resulting viscous oil was taken up in an equal volume (relative to TFA)of DCM and the volatiles evaporated again.This procedure was repeated with anhydrous methanol.Drying the sample under vacuum furnished the intermediate 15as an oil or foam,which was used directly in the next step.Step 3.The intermediate was then dissolved in anhydrous DMF to approximately 150mM,and triethylamine (1equiv)and DMAP (0.1?0.2equiv)were added.Separately,quinolin-3-ylmethyl 1H -imidazole-1-carboxylate (S3a ,1equiv),which was prepared as previously described,22was dissolved in anhydrous DCM to approximately 300mM and the two solutions were then combined.The mixture was stirred at room temperature overnight,and then the volatiles were removed under reduced pressure.The residue was diluted with approximately 10volumes of water (relative to DMF)and extracted with 10volumes of ethyl acetate.Again,the organic layer was washed with 10volumes of sodium bicarbonate twice,followed by 10volumes of brine,dried over sodium sulfate,and evaporated.The crude product 13was typically puri ?ed by silica gel chromatography with a gradient of 80?100%ethyl acetate in pentane,followed by 0?10%methanol in ethyl acetate,by preparative TLC with similar solvent systems or by preparative reverse-phase HPLC in a gradient of acetonitrile in water with 0.1%TFA as acidic modi ?er.(S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (1,aka ERW1041E).Compound 1was prepared according to our recently published scalable synthesis.22HRMS (ESI-QTOF)m /z :calculated for C 20H 22BrN 4O 4+[M +H]+,461.08189;found,461.08278.(S)-Quinolin-3-ylmethyl 3-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)-carbamoyl)-3,4-dihydro-1H-pyrido[3,4-b]indole-2(9H)-carboxylate (2).Compound 2was prepared from (S )-2-(tert -butoxycarbonyl)-2,3,4,9-tetrahydro-1H -pyrido[3,4-b ]indole-3-carbox-ylic acid similar to the general procedure,with the key di ?erence that after deprotecting the Boc group,the intermediate was extracted from a basic aqueous solution with ethyl acetate to yield the free base and this was coupled to the carbonate building block (S4a )instead of the carbamate building block.1H NMR (500MHz,DMSO-d 6)δ10.87and 10.78(2s,1H),9.00and 8.94(2d,J =2.0Hz,1H),8.45?8.32(m,2H),8.07?7.96(m,2H),7.78(t,J =9.4Hz,1H),7.64(t,J =7.5Hz,1H),7.32?7.24(m,1H),7.03(t,J =7.5Hz,1H),6.96(ddd,J =7.9,7.1,1.1Hz,1H),5.48?5.34(m,2H),5.19(t,J =7.0Hz,1H),4.88(dd,J =23.6,16.2Hz,1H),4.70?4.51(m,2H),3.36?3.24(m,1H),3.23?3.07(m,3H),2.99(d,J =8.5Hz,1H),2.79(dt,J =17.6,5.8Hz,1H).HRMS (ESI-QTOF)m /z :calculated for C 27H 25BrN 5O 4+[M +

H]+,562.10844;found,562.10843.(S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)azetidine-1-carboxylate (3a ).Commercial (S )-1-(tert -butoxycarbonyl)azetidine-2-carboxylic acid (500mg,2.485mmol)was coupled to the (S )-DHI moiety as described in step 1of the general procedure,furnishing (S )-tert -butyl 2-((((S )-3-bromo-4,5-

dihydroisoxazol-5-yl)methyl)carbamoyl)azetidine-1-carboxylate

(891mg,2.46mmol,99%yield).The Boc-protected intermediate was directly dissolved in neat TFA (5mL)and stirred for 30min.The crude

mixture was triturated with 20mL of cold diethyl ether.A sticky oil formed on the walls of the vial which thickened upon standing.The ether was decanted o ?and the residue washed with more cold diethyl

ether and then dissolved in a little methanol.The methanol was evaporated and the product dried under vacuum,furnishing (S )-N -(((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)azetidine-2-carboxa-mide,TFA (716mg,1.90mmol,77%yield),as a sticky yellow oil that was used in the next step without any additional puri ?cation.This intermediate was elaborated to the ?nal inhibitor using step 3of the general procedure,furnishing (S )-quinolin-3-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)azetidine-1-carbox-ylate (148.3mg,0.332mmol,17.4%yield)as a white solid.1

H NMR

(500MHz,DMSO-d 6,mixture of rapidly equilibrating rotational isomers)δ8.96?8.82(m,1H),8.48?8.23(m,2H),8.03(d,J =8.5Hz,1H),7.97(d,J =9.7Hz,1H),7.77(t,J =7.5Hz,1H),7.63(ddd,J =8.2,6.8,1.3Hz,1H),5.35?5.16(m,2H),4.81?4.54(m,2H),4.05?3.80(m,2H),3.43?3.18(m,2H,partly obscured by residual water),3.12?2.95(m,1H),2.50?2.42(m,1H),2.06?1.93(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ171.10,155.48,150.54,147.14,138.08,134.64(d,J =51.4Hz),129.84,129.70,128.77,128.10,127.25,126.97,79.96,63.79,61.58(d,J =68.8Hz),47.54(d,J =94.0Hz),43.51,41.29,20.81.HRMS (ESI-

QTOF)m /z :calculated for C 19H 20BrN 4O 4+[M +H]+,447.06624;

found,447.06609.(S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)piperidine-1-carboxylate (3b ).(S )-1-(tert -Butoxycarbonyl)piperidine-2-carboxylic acid (102mg,0.45mmol),EDCI (111mg,0.58mmol),HOBt hydrate (66mg,0.49mmol),and (S )-DHI (80mg,0.45mmol)were dissolved in DMF,and 4-methylmorpholine (49μL,0.45mmol)was added.The mixture was stirred overnight,diluted with 150mL of ethyl acetate,washed with water (3×50mL)and aqueous sodium bicarbonate (50mL),and dried over sodium sulfate.The solvent was removed,and the crude intermediate was deprotected in 5mL of DCM with 1.5mL of TFA for 1h before all volatiles were carefully evaporated under vacuum.The crude TFA salt was redissolved in DMF with 4-methylmorpholine (48.9μL,0.445mmol)and coupled to the carbonate building block S4a (112mg,0.345mmol)for 20h.The solution was then again

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649054D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g

P u

b

l

i c

a

t i

o

n

D

a t

e

(W

e b

):

O c

t o

b e

r

3

1,

2

01

4

|

d

o i

: 1

.1

21

/

j m

501

1

4

5a

diluted with 150mL of ethyl acetate,washed with brine (2×30mL)and water (30mL),dried over sodium sulfate,and evaporated.The crude residue was puri ?ed by reparative TLC (10%methanol in ethyl acetate),a ?ording (S )-quinolin-3-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)piperidine-1-carboxylate (56.7mg,0.119mmol,26.8%yield over three steps)was an o ?-white solid.1H NMR (500MHz,DMSO-d 6)δ8.97?8.83(m,1H),8.38?8.20(m,2H),8.06?7.94(m,2H),7.80?7.69(m,1H),7.67?7.56(m,1H),5.37?5.20(m,2H),4.80?4.60(m,2H),3.98?3.86(m,1H),3.47?3.36(m,1H),3.25?2.94(m,3H),2.08?1.96(m,1H),1.70?1.51(m,3H), 1.41?1.15(m,3H).HRMS (ESI-QTOF)m /z :calculated for C 21H 24BrN 4O 4+[M +H]+,475.09754;found,475.09729.

(R)-Quinolin-3-ylmethyl 3-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate,TFA Salt (3c ).Com-mercial (R )-1-(tert -butoxycarbonyl)pyrrolidine-3-carboxylic acid (250mg,1.16mmol)was elaborated following the modi ?cation to the general procedure reported for compound 3a ,furnishing (R )-quinolin-3-ylmethyl 3-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)-carbamoyl)pyrrolidine-1-carboxylate (199.9mg,0.433mmol,37.3%yield over three steps)as a white solid after puri ?cation by preparative TLC.An aliquot was then further puri ?ed by preparative reverse phase HPLC to yield the title compound.1H NMR (500MHz,DMSO-d 6)δ9.12(d,J =2.1Hz,1H),8.69(s,1H),8.34(q,J =5.7Hz,1H),8.16(d,J =8.0Hz,1H),8.13(d,J =8.5Hz,1H),7.92(ddd,J =8.4,6.9,1.4Hz,1H),7.76(ddd,J =8.1,6.9,1.1Hz,1H),5.33(s,2H),4.77?4.67(m,1H),3.60?3.20(m,7H),3.05?2.95(m,2H),2.11?1.98(m,1H),1.98?1.86(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.81(d,J =12.8Hz),153.57,148.60,143.19,138.65,138.11,131.70,130.88,128.62,128.20,127.70,125.66,80.22,63.38,48.43(d,J =82.2Hz),45.59(d,J =67.9Hz),43.51,42.72(d,J =117.2Hz),41.48,29.15(d,J =105.1Hz).HRMS (ESI-QTOF)m /z :calculated for C 20H 21BrN 4O 4+[M +H]+,461.08189;found,461.08256.

(S)-Quinolin-3-ylmethyl 2-(2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)amino)-2-oxoethyl)pyrrolidine-1-carboxylate (3d ).Commercial (S )-2-(1-(tert -butoxycarbonyl)pyrrolidin-2-yl)acetic acid (250mg,1.090mmol)was elaborated to the ?nal inhibitor using the modi ?cation to the general procedure described for compound 3a ,furnishing the title compound (87mg,0.183mmol,16.8%yield over three steps)as a white solid after puri ?cation by preparative TLC.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.92(d,J =2.1Hz,1H),8.36(d,J =13.0Hz,1H),8.26?8.18(m,1H),8.05?7.97(m,2H),7.77(ddd,J =8.4,6.9,1.5Hz,1H),7.63(ddd,J =8.1,6.9,1.2Hz,1H),5.29(d,J =6.4Hz,2H),4.68(dh,J =11.0,5.8Hz,1H),4.23?3.98(m,1H),3.44?3.14(m,5H),3.00(td,J =17.5,7.4Hz,1H),2.62and 2.51(2dd,J =13.6,3.7Hz,1H,partly obscured by solvent),2.22and 2.15(2dd,J =13.7,10.1Hz,1H),1.97?1.74(m,3H),1.71?1.60(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ170.52(d,J =11.6Hz),153.59(d,J =13.1Hz),150.59(d,J =15.7Hz),147.12(d,J =5.7Hz),138.15,134.56(d,J =26.4Hz),130.20,129.67(d,J =4.4Hz),128.75,128.14,127.32,126.95,80.18,63.79(d,J =14.0Hz),54.71(d,J =69.7Hz),46.23(d,J =51.1Hz),43.55,41.28(d,J =5.1Hz),38.75,29.87(d,J =96.2Hz),22.60(d,J =106.7Hz).HRMS (ESI-QTOF)m /z :calculated for C 21H 24BrN 4O 4+[M +H]+,475.09754;found,475.09800.

(S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)-2-methylpyrrolidine-1-carboxylate (4a ).(S )-1-(tert -Butoxycarbonyl)-2-methylpyrrolidine-2-carboxylic acid (100mg,0.436mmol)was elaborated to the title compound following the general procedure and puri ?ed by preparative TLC (0.9mg,1.9μmol,0.44%yield over three steps).1H NMR (400MHz,chloroform-d )δ8.95(s,1H),8.28and 8.20(2s,1H),8.19?8.10(m,1H),7.86(dd,J =14.4,7.1Hz,1H),7.75(t,J =7.8Hz,1H),7.58(t,J =7.5Hz,1H),6.84(br s,1H),5.46?5.18(m,2H),4.96?4.93and 4.86?4.77(m,1H),3.85?3.37(m,4H),3.16(dd,J =7.9,3.1Hz,1H),2.45?2.33(m,1H),1.95?1.79(m,2H),1.68?1.47(m,5H).HRMS (ESI-QTOF)m /z :calculated for C 21H 24BrN 4O 4+[M +H]+,475.09754;found,475.09826.

(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-?uoropyrrolidine-1-carboxylate (4b ,aka ZH147A).Slightly modifying the published synthesis of the title compound,22(2S ,4S )-1-(tert -butoxycarbonyl)-4-?uoropyrrolidine-2-carboxylic acid (400mg,1.72mmol),EDCI HCl (378mg,1.97mmol),HOBt (232mg, 1.72mmol),and (S )-(3-bromo-4,5-dihydroisoxazol-5-yl)methanamine (307mg, 1.72mmol)were dissolved in 12mL of DMF,and N -methylmorpholine (377μL,3.43mmol)was added.The mixture was stirred for 30min before it was diluted with 120mL of water and extracted with 100mL of ethyl acetate.The organic layer was washed with 100mL of sodium bicarbonate twice and with 100mL of brine,dried over sodium sulfate,and evaporated.The resulting viscous oil was taken up in 10mL of tri ?uoroacetic acid and stirred for 30min before the acid was carefully evaporated.The resulting viscous oil was taken up in 10mL of DCM and the volatiles again evaporated.This procedure was repeated with 10mL of anhydrous methanol.Drying the sample on high vacuum overnight furnished the deprotected intermediate (2S ,4S )-N -(((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)-4-?uoropyrrolidine-2-carbox-amide as its TFA salt in the form of a viscous oil that was directly used in the next step.For this,the viscous oil was diluted with 12mL of anhydrous DMF,and triethylamine (241μL,1.72mmol)and DMAP (21mg,0.17mmol)were added.Separately,quinolin-3-ylmethyl 1H -imidazole-1-carboxylate (434mg,1.72mmol)was dissolved in 6mL of anhydrous DCM and the two solutions combined.After stirring the mixture at room temperature overnight,the volatiles were removed under reduced pressure.The residue was diluted with 100mL of water and extracted with 100mL of ethyl acetate.The organic layer was washed with sodium bicarbonate solution (2×100mL),followed by brine (100mL),drying the organic layer over sodium sulfate and evaporating the volatiles.The crude product was puri ?ed by silica gel chromatography with a gradient of 80?100%ethyl acetate in pentane,followed by 0?10%methanol in ethyl acetate,furnishing (2S ,4S )-quinolin-3-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)-4-?uoropyrrolidine-1-carboxylate (434mg,0.905mmol,52.8%yield over three steps)as a white solid.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.95and 8.87(2d,J =2.1Hz,1H),8.38and 8.28(2s,1H),8.30and 8.20(2t,J =6.1Hz,1H),8.07?7.93(m,2H),7.81?7.73(m,1H),7.63(dddd,J =8.2,6.6,5.1,1.3Hz,1H),5.44?5.17(m,3H),4.70and 4.62(2ddt,J =10.7,7.4,5.3Hz,1H),4.42and 4.33(2d,J =9.7Hz,1H),3.82?3.58(m,2H),3.43?3.12(m,3H,partly obscured by residual water),2.98(ddd,J =22.0,17.6,7.3Hz,1H),2.60?2.35(m,1H,partly obscured by solvent),2.27?2.10(m,1H).13C NMR (126MHz,DMSO-d 6,J CF coupled,mixture of rotational isomers)δ171.67(d,J =26.6Hz),154.07(d,J =31.4Hz),150.54(d,J =20.6Hz),147.15(d,J =7.0Hz),138.16(d,J =21.0Hz),134.53(d,J =38.2Hz),129.90(d,J =8.5Hz),129.69(d,J =9.6Hz),128.78,128.11(d,J =12.2Hz),127.28(d,J =5.5Hz),126.97(d,J =2.6Hz),92.14(dd,J =174.3,124.6Hz),80.02(d,J =6.2Hz),64.24(d,J =14.0Hz),59.02(d,J =63.2Hz),53.53(dd,J =61.6,23.6Hz),43.34,41.02(d,J =15.9Hz),37.22(dd,J =117.3,21.0Hz).HRMS (ESI-QTOF)m /z :calculated for C 20H 21BrFN 4O 4+[M +H]+,479.07247;found,479.07289.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-?uoropyrrolidine-1-carboxylate (4c ).The title compound was prepared as recently described elsewhere.221

H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.93and 8.84(2d,J =2.2Hz,1H),8.46and 8.41(2t,J =6.0Hz,1H),8.36and 8.27(2d,J =1.3Hz,0H),8.04and 8.02(2d,J =3.1Hz,1H),8.00and 7.96(2d,J =8.3Hz,1H),7.78(dddd,J =8.4,6.8,4.3,1.5Hz,1H),7.64(dddd,J =8.1,6.9,2.7,1.2Hz,1H),5.43?5.17(m,3H),4.79?4.65and 4.55?4.46(2m,1H),4.39and 4.30(2dd,J =9.0,7.6Hz,1H),3.89?3.72(m,1H),3.72?3.50(m,1H),3.44?3.32(m,1H,partly obscured by residual water),3.30?3.10(m,2H),3.01and 2.91(2dd,J =17.6,7.3Hz,1H),2.41(dd,J =25.4,11.4Hz,1H,partly obscured by solvent),2.14?1.90(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 20H 21BrFN 4O 4+[M +H]+,479.07247;found,479.07212.

(2S,4R)-Quinolin-3-ylmethyl 4-Amino-2-((((S)-3-bromo-4,5-dihy-droisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate,Bis-

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9055

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

TFA Salt (4d ).Adapting the general procedure,(2S ,4R )-4-((((9H -?uoren-9-yl)methoxy)carbonyl)amino)-1-(tert -butoxycarbonyl)-pyrrolidine-2-carboxylic acid (1.2g,2.65mmol),EDCI HCl (0.585g,3.05mmol),and HOBt hydrate (0.358g,2.65mmol)were dissolved in 5mL of DMF and stirred for 10min,and (S )-DHI (0.475g,2.65mmol)was added.The mixture was allowed to react for 4h before 25mL of water were added,whereby a greasy precipitate formed.The mixture was allowed to sit for 1h before the liquid portion was decanted o ?and the greasy solid material dissolved in 40mL of ethyl acetate.The ethyl acetate was washed with brine and then dried over sodium sulfate before it was evaporated,a ?ording (2S ,4R )-tert -butyl 4-((((9H -?uoren-9-yl)methoxy)carbonyl)amino)-2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (1.3g,2.12mmol,80%yield),which was elaborated to the Fmoc protected inhibitor (2S ,4R )-quinolin-3-ylmethyl 4-((((9H -?uoren-9-yl)-methoxy)carbonyl)amino)-2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate using steps 2and 3of the general procedure.This intermediate was deprotected using piperidine in DCM (1:1)and stirring the mixture for 30min.All volatiles were then removed under reduced pressure and the residue puri ?ed by silica gel chromatography (ethyl acetate/triethylamine 99:1to ethyl acetate/triethylamine/methanol 89:1:10).The product coeluted with a decomposition product where bromide had been displaced by piperidine (approximately in equimolar ratio by NMR,670mg total mass,approximately 30%yield over three steps when corrected for purity).This product was used in the follow-up reactions (vide infra)as it was found easier to remove the decomposition product with the amine further functionalized.For analytical and assay purposes,an aliquot of this mixture was further puri ?ed by reverse-phase HPLC,furnishing the title compound as its TFA salt.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.99and 8.92(2d,J =2.2Hz,1H),8.91?8.86(m,1H),8.45and 8.39(2s,1H),8.14(br s,3H),8.08(d,J =8.4Hz,1H),8.04(t,J =8.5Hz,1H),7.84(ddd,J =8.4,7.0,1.4Hz,1H),7.69(ddd,J =8.1,6.9,1.2Hz,1H),5.42?5.21(m,2H),4.78?4.69and 4.60?4.48(2m,1H),4.41and 4.33(2dd,J =9.0,4.0Hz,1H),3.89?3.81(m,1H),3.77and 3.72(2dd,J =11.5,5.9Hz,1H),3.61and 3.56(2dd,J =11.4,3.7Hz,1H),3.46?3.16(m,3H),3.03and 2.94(2dd,J =17.5,7.4Hz,1H),2.57(tdd,J =16.5,8.7,4.4Hz,1H),1.90(tt,J =14.8,4.3Hz,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ173.38(d,J =24.4Hz),153.42(d,J =29.9Hz),150.07(d,J =22.7Hz),146.10(d,J =25.3Hz),138.19(d,J =27.5Hz),135.91(d,J =17.2Hz),130.36,129.80(d,J =11.6Hz),128.22(d,J =3.9Hz),127.94(d,J =14.9Hz),127.39,127.36(d,J =7.7Hz),79.84(d,J =20.4Hz),64.29(d,J =5.5Hz),58.27(d,J =86.8Hz),50.57(d,J =46.4Hz),48.71(d,J =116.5Hz),43.51(d,J =13.7Hz),41.57(d,J =18.8Hz),33.93(d,J =122.4Hz).

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-hydroxypyrrolidine-1-carboxylate (4e ,aka ZH118).Compound 4e was prepared from commercial (2S ,4R )-1-(tert -butoxycarbonyl)-4-hydroxypyrrolidine-2-carboxylic acid (1.0g,4.32mmol)following the general procedure.Gratifyingly,the crude ?nal product precipitated in high purity from a concentrated solution in ethyl acetate,accounting for the bulk of the isolated yield (266mg),whereas column chromatography of the mother liquor furnished a modest additional yield (120mg)of the title compound (386mg overall yield,0.809mmol,18.7%yield over three steps).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.92and 8.84(2d,J =2.1Hz,1H),8.39and 8.32(2t,J =6.0Hz,1H),8.34and 8.25(2s,1H),8.03(dd,J =8.4,4.4Hz,1H),8.00and 7.96(2d,J =8.3Hz,1H),7.77(dddd,J =8.4,6.9,5.4,1.4Hz,1H),7.63(dddd,J =8.2,6.9,3.0,1.2Hz,1H),5.35?5.17(m,2H),5.10(br s,1H),4.75?4.68and 4.58?4.51(2m,1H),4.38?4.21(m,2H),3.58?3.08(m,5H),3.01and 2.92(2dd,J =17.6,7.2Hz,1H),2.15?2.01(m,1H),1.88?1.77(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.78(d,J =46.3Hz),154.00(d,J =28.0Hz),150.53(d,J =23.4Hz),147.13(d,J =10.0Hz),138.03(d,J =38.8Hz),134.47(d,J =59.6Hz),130.00(d,J =7.7Hz),129.68(d,J =14.6Hz),128.79,128.09(d,J =14.6Hz),127.28(d,J =5.0Hz),126.98(d,J =5.1Hz),80.14(d,J =24.0Hz),68.23(d,J =85.6Hz),

64.00,58.76(d,J =76.9Hz),55.25(d,J =63.9Hz),43.36,41.16(d,J =37.0Hz),38.92.HRMS (ESI-QTOF)m /z :calculated for C 20H 22BrN 4O 5+[M +H]+,477.07681;found,477.07752.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-methoxypyrrolidine-1-carboxylate (5a ).(2S ,4R )-1-tert -Butyl 2-methyl 4-hydroxypyrrolidine-1,2-dicarbox-ylate (0.347g,1.41mmol)and sodium hydride (0.0865g,60%suspension in mineral oil)were individually dissolved in DMF,and the solutions were combined at ?10°C and stirred for 30min before iodomethane (0.265mL,4.24mmol)was added.After an additional hour,the cooling bath was removed and stirring continued at room temperature for 15h.The solution was diluted with 50mL of DCM and washed with brine (4×30mL).The organic phase was dried over sodium sulfate,evaporated,and the residue puri ?ed by silica gel chromatography (10?50%ethyl acetate in pentane,R f =0.5in 1:1ethyl acetate/pentane)to furnish (2S ,4R )-1-tert -butyl 2-methyl 4-methoxypyrrolidine-1,2-dicarboxylate (93mg,0.359mmol,25.4%yield).This intermediate was dissolved in THF and 1M LiOH added to hydrolyze the methyl ester.Once the reaction was complete,THF was evaporated,the solution acidi ?ed to pH 3?4with 1M HCl,and extracted with ethyl acetate.The amino acid was then elaborated to the ?nal inhibitor using the procedure described for compound 3b .1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.93and 8.84(2d,J =2.2Hz,1H),8.40and 8.33(2t,J =5.9Hz,1H),8.36and 8.26(2s,1H),8.07?7.94(m,2H),7.78(tdd,J =8.3,6.2,1.4Hz,1H),7.69?7.61(m,1H),5.35?5.16(m,2H),4.78?4.66and 4.60?4.49(2m,1H),4.29and 4.20(2t,J =7.9Hz,1H),4.01?3.93(m,1H),3.60?3.44(m,2H),3.43?3.24(m,2H,partly obscured by residual water),3.22(d,J =3.4Hz,3H),3.20?3.10(m,1H),3.02and 2.93(2dd,J =17.6,7.2Hz,1H),2.31?2.18(m,1H),1.93?1.81(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 21H 24BrN 4O 5+[M +H]+,491.09246;found,491.09213.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(prop-2-yn-1-yloxy)pyrrolidine-1-car-boxylate (5b ).The title compound was prepared as recently described elsewhere.22HRMS (ESI-QTOF)m /z :calculated for C 23H 24BrN 4O 5+[M +H]+,515.09246;found,515.09216.

(2S,4R)-Quinolin-3-ylmethyl 4-(Benzyloxy)-2-((((S)-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (5c ,aka ZH105).Compound 5c was prepared from commercial (2S ,4R )-4-(benzyloxy)-1-(tert -butoxycarbonyl)pyrrolidine-2-carboxylic acid using the general procedure,furnishing (2S ,4R )-quinolin-3-ylmethyl 4-(benzyloxy)-2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (828mg, 1.46mmol,46.9%yield over three steps)as a white foam after silica gel chromatography.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.92and 8.84(2d,J =2.1Hz,1H),8.41and 8.35(2t,J =6.0Hz,1H),8.32and 8.25(2d,J =1.4Hz,1H),8.08?8.00(m,1H),7.95(ddd,J =11.1,8.2,1.6Hz,1H),7.80?7.74(m,1H),7.62(ddd,J =8.1,6.9,1.2Hz,1H),7.36?7.23(m,5H),5.35?5.17(m,2H),4.72and 4.54(2ddt,J =10.5,7.4,5.0Hz,1H),4.47(s,2H),4.36and 4.27(2t,J =7.8Hz,1H),4.17(m,1H),3.67?3.49(m,2H),3.44?3.10(m,3H,partly obscured by residual water),3.02and 2.93(2dd,J =17.6,7.3Hz,1H),2.39?2.26(m,1H),1.98?1.87(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.45(d,J =43.5Hz),153.91(d,J =24.8Hz),150.52(d,J =23.1Hz),147.13(d,J =10.4Hz),138.22(d,J =4.9Hz),137.90,134.47(d,J =55.3Hz),129.90(d,J =6.2Hz),129.67(d,J =12.7Hz),128.78,128.27(d,J =2.7Hz),128.07(d,J =13.7Hz),127.57(d,J =5.4Hz),127.50(d,J =3.1Hz),127.26(d,J =5.0Hz),126.95(d,J =3.2Hz),80.12(d,J =24.0Hz),76.13(d,J =92.1Hz),69.92(d,J =3.0Hz),64.10,58.64(d,J =74.1Hz),52.25(d,J =60.3Hz),43.38,41.19(d,J =34.4Hz),36.42(d,J =120.4Hz).HRMS (ESI-QTOF)m /z :calculated for C 27H 28BrN 4O 5+[M +H]+,567.12376;found,567.12373.

(2S,4R)-Quinolin-3-ylmethyl 4-Benzyl-2-((((S)-3-bromo-4,5-dihy-droisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate,TFA Salt (6).Commercial (2S ,4R )-4-benzyl-1-(tert -butoxycarbonyl)-pyrrolidine-2-carboxylic acid (100mg,0.327mmol)was elaborated to the ?nal inhibitor following the general procedure and puri ?ed by preparative TLC,furnishing (2S ,4R )-quinolin-3-ylmethyl 4-benzyl-2-

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9056

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)-pyrrolidine-1-carboxylate (112.8mg,0.205mmol,62.7%yield over three steps).An aliquot of the inhibitor was further puri ?ed by reverse-phase HPLC.1

H

NMR

(500

MHz,

DMSO-

d 6,mixture

of

rotational

isomers)δ9.08and 8.99(2d,J =2.1Hz,1H),8.62and 8.55(2s,1H),8.34and 8.25(2t,J =6.0Hz,1H),8.15?8.06(m,2H),7.91(ddd,J =8.5,6.9,1.4Hz,1H),7.79?7.72(m,1H),7.32?7.23(m,2H),7.22?7.14(m,3H),5.38?5.20(m,2H),4.70and 4.58(2ddt,J =10.2,7.2,4.9,11.9,7.1,4.9Hz,

1H),4.36

and

4.25

(2dd,

J

=8.8,

2.5

Hz,1H),3.56and 3.49(2dd,J =10.2,7.3Hz,1H),3.42?3.05(m,4H),2.94(ddd,J =20.3,17.5,7.1Hz,1H),2.68?2.57(m,2H),2.55?2.42(m,1H,partly obscured by solvent),1.94(ddt,J =30.7,12.5,9.3Hz,1H),1.87?1.76(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.66(d,J =37.4Hz),153.67(d,J =

41.4Hz),148.66(d,J =61.7Hz),143.63(d,J =47.2Hz),140.21,138.05,137.85,131.45(d,J =4.2Hz),130.65(d,J =5.4Hz),128.65(d,J =5.6Hz),128.52,128.51?128.35(m),128.08(d,J =8.7Hz),127.59(d,J =2.6Hz),126.14,125.94,80.10(d,J =15.5Hz),63.52(d,J =13.5

Hz),

59.78

(d,

J =

74.4Hz),51.77(d,J =73.8Hz),43.34,

41.24(d,J =27.6Hz),38.45(d,J =97.8Hz),37.96(d,J =16.1Hz),36.41(d,J =109.2Hz).HRMS (ESI-QTOF)m /z :calculated for C 27H 28BrN 4O 4+[M +H]+,551.12884;found,551.12961.(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-phenylpyrrolidine-1-carboxylate (7a ,aka CK805).The title compound was prepared from commercial (2S ,4S )-1-(tert -butoxycarbonyl)-4-phenylpyrrolidine-2-carboxylic by the general procedure,furnishing (2S ,4S )-quinolin-3-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)-4-phe-nylpyrrolidine-1-carboxylate (81mg,0.151mmol,43.9%yield over three steps)as a white solid.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.93and 8.86(2d,J =2.2Hz,1H),8.41and 8.35(2t,J =6.1Hz,1H),8.36and 8.27(2d,J =1.6Hz,1H),8.03(d,J =8.3Hz,1H),7.99(dd,J =17.0,8.0Hz,1H),7.77(ddt,J =8.1,6.9,1.1Hz,1H),7.67?7.60(m,1H),7.35?7.27(m,4H),7.26?7.19(m,

1H),5.37?5.20(m,2H),4.80?4.71and 4.66?4.59(2m,1H),4.46and 4.37(2dd,J =8.8,2.2Hz,1H),3.98and 3.91(2dd,J =9.8,7.6Hz,1H),3.54?3.18(m,5H,partly obscured by residual water),3.04(ddd,J =26.4,17.6,7.2Hz,1H),2.43?2.28(m,1H),2.18?2.08(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.52(d,J =33.1Hz),153.68(d,J =41.6Hz),150.50(d,J =25.3Hz),147.12(d,J =7.8Hz),140.62(d,J =22.0Hz),138.02(d,J =26.7Hz),134.42(d,J =52.0Hz),129.98(d,J =4.6Hz),129.65(d,J =8.8Hz),128.76(d,J =3.2Hz),128.54(d,J =4.4Hz),128.09(d,J =15.0Hz),127.27(d,J =3.9Hz),127.15(d,J =3.3Hz),126.86(d,J =21.8Hz),80.11(d,J =14.2Hz),64.03(d,J =15.0Hz),59.93(d,J =75.6Hz),52.98

(d,J =61.1Hz),43.41,

41.56

(d,J =59.3Hz),40.99

(d,J =36.4Hz),37.82(d,J =132.7Hz).HRMS (ESI-QTOF)m /z :calculated for C 26H 26BrN 4O 4+[M +H]+,537.11319;found,537.11300.(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-phenylpyrrolidine-1-carboxylate (7b ).(S )-1-(tert -butoxycarbonyl)-4-phenyl-2,5-dihydro-1H -pyrrole-2-carboxylic acid

(18b

,where R

=phenyl)was prepared analogously

as steps 1and 2of compound 7e .An aliquot (64mg,0.221mmol)was dissolved in 10mL of ethanol (200proof),and palladium 10%on carbon (23.5mg)was added.The round-bottom ?ask was capped with a septum and purged with hydrogen gas brie ?y and kept under a slight positive pressure

of

hydrogen

while stirring overnight.The reaction

mixture was then ?ltered through a small layer of silica gel sandwiched between layers of sand in a pipet column.The matrix was washed with additional ethanol,and the combined ?ltrate was evaporated under reduced pressure,yielding (2S ,4R )-1-(tert -butoxycarbonyl)-4-phenyl-pyrrolidine-2-carboxylic acid (19b ,where R =phenyl,50mg,0.172

mmol,78%yield),which was then elaborated to the ?nal inhibitor using the general procedure (43.3mg,0.081mmol,47.1%yield over three steps).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.97?8.84(m,1H),8.45?8.38(m,1H),8.37and 8.28(2s,1H),8.11?7.91(m,2H),7.77(tt,J =8.2,1.3Hz,1H),7.67?

7.60

(m,

1H),7.37?7.21(m,5H),5.38?5.19(m,2H),4.79?4.52(m,1H),4.42?4.23(m,1H),4.13?3.97(m,1H),3.53?2.90(m,6H),2.70? 2.53(m,1H), 1.94?1.79(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 26H 26BrN 4O 4+[M +H]+,537.11319;found,537.11291.(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-

zol-5-yl)methyl)carbamoyl)-4-(2-hydroxyphenyl)pyrrolidine-1-car-boxylate,TFA Salt (7c ).Compound 7c was prepared analogously to

compound 7e ,with the exception that in the amide coupling reaction within step 4,HBTU (1equiv)was used as the coupling agent in place of EDCI HCl with HOBt.The ?nal product was puri ?ed by reverse phase HPLC,furnishing the title compound as its TFA salt (4.9mg,0.0073mmol,0.92%yield over six steps).1H NMR (400MHz,

DMSO-d 6,mixture of rotational isomers)δ9.52(br s,1H),8.97and 8.89(2d,J =2.1Hz,1H),8.46?8.28(m,2H),8.08?7.97(m,2H),7.81(ddd,J =8.5,6.9,1.4Hz,1H),7.70?7.61(m,1H),7.09(dd,J =7.7,1.6Hz,1H),7.06?6.98(m,1H),6.79(ddd,J =7.2,5.7,1.2Hz,1H),6.76?6.65(m,1H),5.38?5.18(m,2H),4.77?4.68and 4.63?

4.53(2m,1H),4.42and 4.32(2dd,J =8.7,3.1Hz and 8.8,2.6,1H),3.92and 3.84(2dd,J =10.0,7.6Hz,1H),3.66(dt,J =1

5.8,8.0Hz,1H),3.46?3.29(m,2H),3.30?2.91(m,3H),2.46?2.30(m,1H),2.12?1.97(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 26H 26BrN 4O 5+[M +H]+,553.10811;

found,553.10750(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(3-hydroxyphenyl)pyrrolidine-1-car-boxylate,TFA Salt (7d ).Compound 7d was prepared using the

procedure of compound 7c and puri ?ed by reverse phase HPLC,

furnishing the title compound as its TFA salt (6.7mg,0.010mmol,

1.3%yield over six steps).1H NMR (400MHz,DMSO-d 6,mixture of rotational isomers)δ9.37(br s,1H),8.99and 8.90(2s,1H),8.48?

8.29(m,2H),8.10?7.94(m,2H),7.85?7.76(m,1H),7.66(d,J =8.9

Hz,1H),7.09(q,J =7.3Hz,1H),6.75?6.56(m,3H),5.40?5.20(m,

2H),4.80?4.57(m,1H),4.49?4.31(m,1H),3.98?3.82(m,1H),

3.47?3.15(m,4H),3.15?2.95(m,2H),2.38?2.22(m,1H),2.11(s,

1H).

HRMS (ESI-QTOF)m /z :calculated for C 26H 26BrN 4O 5+[M +

H]+,

553.10811;found,553.10725.(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(4-hydroxyphenyl)pyrrolidine-1-car-boxylate

(7e ,aka CK937).Step 1:(S)-1-tert-Butyl 2-Methyl 4-(4-Hydroxyphenyl)-1H-pyrrole-1,2(2H,5H)-dicarboxylate.Adapting a

procedure from the patent literature by Nakai and co-workers,39(4-

hydroxyphenyl)boronic acid (0.367g, 2.66mmol)and tetrakis-

(triphenylphosphine)palladium(0)(0.308g,0.266mmol)were

placed in a 50mL round-bottom ?ask and dissolved in 20mL of

dioxane.Then (S )-1-tert -butyl 2-methyl 4-(((tri ?uoromethyl)-

sulfonyl)oxy)-1H -pyrrole-1,2(2H ,5H )-dicarboxylate (17,1g, 2.66

mmol),prepared from (S )-1-tert -butyl 2-methyl 4-oxopyrrolidine-1,2-dicarboxylate (synthesized from 16by the method of Qiu 40),as

described in the literature reference,was added,followed by potassium carbonate (4.00mL,7.99mmol)as an aqueous solution.The mixture

was placed in an oil bath that had been preheated to 80°C and stirred for 20min,by which time the solution had turned from orange to dark black,indicating completion.The solution was concentrated under reduced pressure and then diluted with water (50mL).Aqueous HCl was added to adjust the pH to approximately 5.The mixture was extracted with ethyl acetate (2×50mL),and the combined organic extracts were dried and then ?ltered through a plug of silica.Removal

of the volatiles furnished a gray crude product that was puri ?ed by silica gel chromatography in 10?25%ethyl acetate in pentane to yield (S )-1-tert -butyl 2-methyl 4-(4-hydroxyphenyl)-1H -pyrrole-1,2-(2H ,5H )-dicarboxylate (18a ,where R =p -hydroxyphenyl,0.484g,1.52mmol,56.9%yield)(R

f in 15%ethyl acetate in pentane approximately 0.15).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ9.72(s,1H),7.32(dd,J =8.7,6.9Hz,2H),6.79?6.72(m,2H),6.08(m,1H),5.02(dt,J =5.2,2.7Hz,1H),4.44(ddt,J =9.5,4.6,2.1Hz,2H),3.68and 3.65(2s,3H),1.44and 1.36(2s,9H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ170.82(d,J =49.7Hz),158.05,152.82(d,J =72.9Hz),139.91(d,J =42.3Hz),127.38(d,J =5.5Hz),123.07,115.52(d,J =16.8Hz),114.87(d,J =12.8Hz),79.44(d,J =27.2Hz),66.75(d,J =33.8Hz),53.27(d,J =7.6Hz),52.11(d,J =8.2Hz),28.01(d,J =25.5Hz).

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?90649057D o w n l o a d e d b y N A N J I N G U N I V O F T E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u

b l

i c

a

t

i o

n

D

a t

e

(W

e b

)

:

O

c t o

b e

r

3

1,

2

01

4

|

d o

i

: 1

.1

21

/

j m

50

11

4

5a

Step 2:(S)-1-(tert-Butoxycarbonyl)-4-(4-hydroxyphenyl)-2,5-dihy-dro-1H-pyrrole-2-carboxylic Acid.(S )-1-tert -Butyl 2-methyl 4-(4-hydroxyphenyl)-1H -pyrrole-1,2(2H ,5H )-dicarboxylate (484mg,1.52mmol)was dissolved in THF (40mL)and methanol (20mL).To the stirred solution,20mL of LiOH (1M in water)was added and the reaction monitored by TLC (50%EtOAc/pentane).Then an equimolar amount of 1M hydrochloric acid was added and the volatiles were removed under reduced pressure.The residue was taken up in additional water (50mL ?nal volume),the pH adjusted to 3?4using hydrochloric acid,and the aqueous phase extracted with ethyl acetate (3×50mL).The combined extracts were dried over sodium sulfate and the solvent evaporated,yielding (S )-1-(tert -butoxycarbon-yl)-4-(4-hydroxyphenyl)-2,5-dihydro-1H -pyrrole-2-carboxylic acid (18b ,where R =p -hydroxyphenyl,431mg,1.41mmol,93%yield)as an o ?-white foam that was used without further puri ?cation.

Step 3:(2S,4S)-1-(tert-Butoxycarbonyl)-4-(4-hydroxyphenyl)-pyrrolidine-2-carboxylic Acid.Inspired by the report of Zhang and co-workers,43(S )-1-(tert -butoxycarbonyl)-4-(4-hydroxyphenyl)-2,5-di-hydro-1H -pyrrole-2-carboxylic acid (431mg, 1.41mmol)and chlorotris(triphenylphosphine)rhodium(I)(131mg,0.141mmol)were brought under an atmosphere of argon and dissolved in anhydrous THF (24mL),methanol (24mL),and triethylamine (198μL,1.41mmol).The atmosphere in the ?ask was then changed to hydrogen and a slight positive pressure maintained while the solution was stirred overnight.The volatiles were evaporated,the residue suspended in aqueous sodium bicarbonate (100mL),and the pH adjusted to approximately 10with 1M aqueous sodium hydroxide.Ethyl acetate (100mL)was then added and the mixture partitioned.The organic layer was washed with another 50mL of sodium bicarbonate solution,and the combined aqueous layers were brought to pH 3?4using 1M aqueous hydrochloric acid and the product subsequently back-extracted with ethyl acetate (3×100mL).The combined organic layers were dried over sodium sulfate and evaporated to furnish (2S ,4S )-1-(tert -butoxycarbonyl)-4-(4-hydroxyphenyl)pyrrolidine-2-carboxylic acid (19a ,where R =p -hydroxyphenyl,384mg,1.25mmol,89%yield)as an o ?-white foam in good purity.1H NMR (400MHz,methanol-d 4,mixture of rotational isomers)δ7.08(d,J =8.4Hz,2H),6.74(d,J =8.5Hz,2H),4.41and 4.37(2dd,J =8.9,2.2Hz,1H),3.86(ddd,J =12.5,10.2,7.7Hz,1H),3.50?3.38(m,1H),3.34?3.26(m,1H,partly obscured by solvent),2.44?2.33(m,1H),2.29(ddd,J =13.1,6.8,2.6Hz,1H),1.47and 1.44(2s,9H).

Step 4:(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihy-droisoxazol-5-yl)methyl)carbamoyl)-4-(4-hydroxyphenyl)-pyrrolidine-1-carboxylate.An aliquot of the amino acid (2S ,4S )-1-(tert -butoxycarbonyl)-4-(4-hydroxyphenyl)pyrrolidine-2-carboxylic acid (250mg,0.813mmol)was elaborated into the ?nal inhibitor using the general procedure and puri ?ed by silica gel chromatography (80?100%ethyl acetate in pentane,followed by 0?15%methanol in ethyl acetate),furnishing the title compound as a white foam (264mg,0.477mmol,58.7%yield over three steps).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ9.31(s,1H),8.93and 8.86(2d,J =2.1Hz,1H),8.40and 8.33(2t,J =6.1Hz,1H),8.35and 8.26(2d,J =1.1Hz,1H),7.77(ddd,J =8.4,6.9,1.5Hz,1H),7.63(dddd,J =8.1,6.9,4.1,1.2Hz,1H),7.07(dd,J =8.7,2.7Hz,2H),6.69(t,J =8.1Hz,2H),5.35?5.19(m,2H),4.79?4.71and 4.66?4.59(2m,1H),4.44and 4.35(dd,J =8.8,2.0Hz,1H),3.91and 3.84(2dd,J =9.5,7.3Hz,1H),3.45?3.18(m,5H),3.03(ddd,J =25.1,17.6,7.2Hz,1H),2.28(dtd,J =24.4,12.2,9.0Hz,1H),2.13?2.01(m,1H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.61(d,J =33.3Hz),156.13,153.70(d,J =43.8Hz),150.50(d,J =26.0Hz),147.13(d,J =7.7Hz),138.05(d,J =26.3Hz),134.41(d,J =52.2Hz),130.55(d,J =19.4Hz),130.02(d,J =4.6Hz),129.67(d,J =9.1Hz),128.77(d,J =3.0Hz),128.17,128.07,127.29(d,J =3.8Hz),126.96,115.26(d,J =4.8Hz),80.13(d,J =14.1Hz),64.02(d,J =15.9Hz),59.98(d,J =73.6Hz),53.22(d,J =60.6Hz),43.42,41.23(d,J =24.8Hz),40.16,38.09(d,J =131.5Hz).HRMS (ESI-QTOF)m /z :calculated for C 26H 26BrN 4O 5+[M +H]+,553.10811;found,553.10762.

(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(3-chlorophenyl)pyrrolidine-1-car-boxylate,TFA Salt (7f ).Compound 7f was prepared using the procedure of compound 7c and puri ?ed by reverse phase HPLC,furnishing the title compound as its TFA salt (8.5mg,0.012mmol,1.6%yield over six steps)..1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ9.01and 8.92(2s,1H),8.51?8.30(m,2H),8.11?7.99(m,2H),7.83(dd,J =8.5,6.7Hz,1H),7.74?7.65(m,1H),7.39(s,1H),7.38?7.24(m,3H),5.43?5.21(m,2H),4.80?4.58(m,1H),4.45and 4.36(2t,J =9.0and 8.3Hz,1H),4.03?3.89(m,1H),3.59?3.17(m,5H),3.15?2.94(m,1H),2.45?2.28(m,1H),2.23?2.08(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 26H 25BrClN 4O 4+[M +H]+,571.07422;found,571.07262.

(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(4-chlorophenyl)pyrrolidine-1-car-boxylate,TFA Salt (7g ).Compound 7g was prepared using the procedure of compound 7c and puri ?ed by reverse phase HPLC,furnishing the title compound as its TFA salt (8.0mg,0.012mmol,1.5%yield over six steps).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ9.01and 8.93(2d,J =2.1Hz,1H),8.53?8.32(m,2H),8.14?7.99(m,2H),7.84(dd,J =8.6,6.8Hz,1H),7.70(td,J =7.6,2.8Hz,1H),7.41?7.28(m,4H),5.41?5.22(m,2H),4.82?4.57(m,1H),4.46and 4.37(t,J =9.4and 8.8Hz,1H),4.04?3.87(m,1H),3.56?3.17(m,5H),3.17?2.94(m,1H),2.35(ddd,J =23.1,19.6,10.5Hz,1H),2.22?2.07(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 26H 25BrClN 4O 4+[M +H]+,571.07422;found,571.07298.

(2S,4S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(5-?uoro-1H-indol-3-yl)pyrrolidine-1-carboxylate,TFA Salt (7h ).tert -Butyl 5-?uoro-3-iodo-1H -indole-1-carboxylate 21was prepared from 5-?uoroindole 20using the procedure reported by Tasch and co-workers 59and an aliquot (350mg,0.969mmol)then subjected to the Masuda borylation conditions described in the same report,except that 2equiv of pinacolborane (HBPin)were used.One hour after initiating the borylation reaction,all components for the Suzuki coupling reaction as described in step 1of compound 7e ,including another aliquot of catalyst,were added to the hot reaction mixture.The bright-red crude material (18a ,where R =5-?uoro-1H -indol-3-yl)was hydrolyzed as described in step 2of compound 7e and brie ?y puri ?ed by extraction and back-extraction,furnishing (S )-1-(tert -butoxycarbonyl)-4-(5-?uoro-1H -indol-3-yl)-2,5-dihydro-1H -pyrrole-2-carboxylic acid (19a ,where R =5-?uoro-1H -indol-3-yl,159.3mg,0.460mmol,47.5%yield)as an orange solid that was reduced as described above (step 3)over a period of 42h.The crude product was puri ?ed by reverse-phase HPLC with an isocratic method of 40%acetonitrile in water (+0.1%TFA).An aliquot of (2S ,4S )-1-(tert -butoxycarbonyl)-4-(5-?uoro-1H -indol-3-yl)pyrrolidine-2-carboxylic acid (15.2mg,0.044mmol)was then elaborated to the ?nal inhibitor using the procedure outlined for compound 7e with HBTU (1equiv)as the amide coupling agent instead of EDCI HCl with HOBt (see 7c ).The crude product was puri ?ed by reverse-phase HPLC,furnishing the title compound as its TFA salt (14mg,0.020mmol,45.4%yield over three steps).1H NMR (400MHz,DMSO-d 6,mixture of rotational isomers)δ11.04(s,1H),9.00and 8.92(2d,J =2.1Hz,1H),8.48?8.28(m,2H),8.11?7.98(m,2H),7.89?7.78(m,1H),7.68(q,J =7.5Hz,1H),7.39?7.27(m,3H),7.01?6.83(m,1H),5.42?5.20(m,2H),4.82?4.59(m,1H),4.53?4.33(m,1H),4.09?3.88(m,1H),3.74?3.57(m,1H),3.55?3.44(m,1H),3.44?3.19(m,3H),3.15?2.95(m,1H),2.47?2.33(m,1H),2.27?2.11(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 28H 26BrFN 5O 4+[M +H]+,594.11467;found,594.11403.

(S)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)-carbamoyl)-4-phenyl-2,5-dihydro-1H-pyrrole-1-carboxy-late,TFA Salt (8).(S )-1-tert -Butyl 2-methyl 4-phenyl-1H -pyrrole-1,2(2H ,5H )-dicarboxylate was prepared analogously to step 1of compound 7e (254mg,0.837mmol,62.9%yield).The remainder of the synthesis followed a reversed sequence.An aliquot of the intermediate (100mg,0.33mmol)was deprotected using 4M HCl in dioxane for 30min.The solvent was carefully evaporated and the residue redissolved in methanol and evaporated again.The HCl salt thus obtained was coupled to quinolin-3-ylmethyl 1H -imidazole-1-

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9058

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

carboxylate analogously to step 3of the general procedure,furnishing (S )-2-methyl 1-(quinolin-3-ylmethyl)4-phenyl-1H -pyrrole-1,2-(2H ,5H )-dicarboxylate,which was puri ?ed by preparative TLC.The methyl ester was saponi ?ed analogously to step 2of compound 7e and the free acid eventually coupled to (S )-DHI as described in step 1of the general procedure but with one equivalent of HBTU in place of EDC and HOBt as the coupling reagent.Reverse-phase HPLC furnished the compound as its TFA salt (5.1mg,7.9μmol,2.4%yield over four steps).1H NMR (400MHz,DMSO-d 6,mixture of rotational isomers)δ9.06and 8.94(2d,J =2.2Hz,1H),8.54and 8.43(2s,1H),8.53?8.44(m,1H),8.12?8.00(m,2H),7.84(t,J =7.4Hz,1H),7.69(t,J =7.5Hz,1H),7.56?7.47(m,1H),7.43?7.29(m,2H),6.32?6.21(m,1H),5.47?5.25(m,2H),5.21?5.04(m,1H),4.78?4.52(m,3H), 3.45?2.88(m,4H).HRMS (ESI-QTOF)m /z :calculated for C 26H 24BrN 4O 4+[M +H]+,535.09754;found,535.09716.

(2S,4R)-Quinolin-3-ylmethyl 4-Benzamido-2-((((S)-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (9a ).Compound 4d (30mg,0.063mmol)in the semipure form obtained from silica gel chromatography was dissolved in DMF (0.5mL).Separately,benzoic acid (23.1mg,0.189mmol),EDCI HCl (36.2mg,0.189mmol),and HOBt (8.5mg,0.063mmol)were dissolved in DMF (0.5mL),and N -methylmorpholine (20.8μL,0.189mmol)was added.The two solutions were combined and stirred for 2h.Water and ethyl acetate (10mL each)were then added and the mixture partitioned.The organic layer was washed with aqueous sodium bicarbonate (2×10mL)and brine (10mL),dried over sodium sulfate,and subsequently evaporated.The crude residue was puri ?ed by preparative TLC,furnishing the title compound as an o ?-white solid (11.5mg,0.020mmol,31.5%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.93and 8.86(2d,J =2.2Hz,1H),8.65(t,J =7.3Hz,1H),8.57and 8.51(2t,J =6.0Hz,1H),8.36and 8.28(2d,J =1.1Hz,1H),8.03(d,J =8.4Hz,1H),8.01?7.93(m,1H),7.84?7.80(m,2H),7.77(ddd,J =8.4,6.9,1.5Hz,1H),7.67?7.60(m,1H),7.56?7.50(m,1H),7.50?7.44(m,2H),5.35?5.20(m,2H),4.75?4.67and 4.57?4.48(2m,2H),4.38and 4.29(2dd,J =8.6,5.7Hz,1H),3.84and 3.78(2dd,J =10.6,6.5Hz,1H),3.50?3.10(m,4H),3.00and 2.91(2dd,J =17.5,7.5Hz,1H),2.62?2.45(m,1H,partly obscured by solvent),1.96?1.85(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 27H 27BrN 5O 5+[M +H]+,580.11901;found,580.11897.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(2-hydroxybenzamido)pyrrolidine-1-carboxylate (9b ).Compound 9b was prepared from semipure 4d (30mg,0.063mmol)and 2-hydroxybenzoic acid (8.7mg,0.063mmol)as described for compound 9a but with only one equivalent of all reagents.Puri ?cation of the crude mixture by preparative TLC furnished the title compound (6.9mg,0.012mmol,18.4%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ12.33(d,J =3.0Hz,1H),8.96(t,J =7.0Hz,1H),8.94and 8.86(2d,J =2.2Hz,1H),8.58and 8.52(2t,J =6.0Hz,1H),8.36and 8.28(2d,1.5and 2.2Hz,1H),8.06?7.94(m,2H),7.82?7.73(m,2H),7.63(tdd,J =6.9,4.5,1.3Hz,1H),7.40(td,J =7.7,1.7Hz,1H),6.93?6.86(m,2H),5.37?5.20(m,2H),4.75?4.67and 4.62?4.49(2br m,2H),4.39and 4.30(2dd,J =8.8,5.3Hz,1H),3.86and 3.80(dd,J =10.7,6.5Hz,1H),3.46(ddd,J =31.0,10.6,5.1Hz,1H),3.39?3.09(m,3H),2.99and 2.91(2dd,J =17.5,7.4Hz,1H),2.66?2.51(m,1H),1.97?1.85(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 27H 27BrN 5O 6+[M +H]+,596.11392;found,596.11434.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(3-hydroxybenzamido)pyrrolidine-1-carboxylate (9c ).Compound 9c was prepared analogously to compound 9b (4.6mg,7.71μmol,12.3%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ10.31(br s,1H),8.93and 8.85(2d,J =2.2Hz,1H),8.67?8.50(m,2H),8.36and 8.28(2d,J =1.5and 2.2Hz,1H),8.12?7.89(m,2H),7.77(ddd,J =8.4,6.9,1.5Hz,1H),7.67?7.60(m,1H),7.31?7.14(m,3H),6.92(dt,J =7.2,2.4Hz,1H),5.36?5.20(m,2H),4.82?4.41(m,2H),4.32(ddd,J =48.9,8.6,5.6Hz,1H),3.79(ddd,J =31.9,10.6,6.5Hz,1H),3.53?3.19(m,3H),3.18?3.09(m,1H),2.96(ddd,J =43.1,17.5,7.3Hz,

1H),2.58?2.44(m,1H,partly obscured by solvent),2.03?1.83(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 27H 27BrN 5O 6+[M +H]+,596.11392;found,596.11339.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(4-hydroxybenzamido)pyrrolidine-1-carboxylate (9d ,aka CK999).Compound 9d was prepared analogously to compound 9e .It is noteworthy that the title compound precipitated from an ethyl acetate solution of the crude ?nal material in high purity and satisfactory yield (200mg,0.335mmol,18.8%yield over 5steps),obviating the need for a chromatographic puri ?cation step.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ10.10(br s,1H),8.93and 8.85(2d,J =2.2Hz,1H),8.56and 8.49(2t,J =6.0Hz,1H),8.38(t,J =7.3Hz,1H),8.35and 8.28(2d,J =1.3Hz,1H),8.03(d,J =8.4Hz,1H),7.98(ddd,J =10.1,8.3,1.4Hz,1H),7.77(ddd,J =8.4,6.9,1.5Hz,1H),7.68(dd,J =8.6,5.4Hz,2H),7.66?7.60(m,1H),6.79(dd,J =8.7,2.9Hz,2H),5.39?5.18(m,2H),4.76?4.66and 4.56?4.44(2m,2H),4.36and 4.27(2dd,J =8.6,5.8Hz,1H),3.82and 3.75(2dd,J =10.5,6.4Hz,1H),3.52?3.27(m,2H,partly obscured by residual water),3.26?3.10(m,2H),2.99and 2.91(2dd,J =17.5,7.5Hz,1H),2.57?2.43(m,1H,partly obscured by solvent),1.92?1.80(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 27H 27BrN 5O 6+[M +H]+,596.11392;found,596.11359.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(nicotinamido)pyrrolidine-1-carboxy-late (9e ,aka CK996).Step 1:(2S,4R)-1-tert-Butyl 2-Methyl 4-(nicotinamido)pyrrolidine-1,54f171090975f46526d3e14fmercial (2S ,4R )-1-tert -butyl 2-methyl 4-aminopyrrolidine-1,2-dicarboxylate,HCl (500mg,1.781mmol),nicotinic acid (439mg,3.56mmol),EDC HCl (683mg,3.56mmol),and HOBt (241mg,1.781mmol)were dissolved in 10mL of DMF,and N -methylmorpholine (392μL,3.56mmol)was added.The mixture was stirred at room temperature overnight before it was diluted with 100mL of water and extracted with 100mL of ethyl acetate.The organic layer was washed with 100mL of aqueous sodium bicarbonate solution twice,followed by 100mL of brine.After drying the organic layer over sodium sulfate,the volatiles were removed under reduced pressure,furnishing the product as yellowish oil.

Step 2:(2S,4R)-1-(tert-Butoxycarbonyl)-4-(nicotinamido)-pyrrolidine-2-carboxylic Acid.To saponify the methyl ester,the intermediate was dissolved in THF (30mL)and methanol (10mL)and aqueous lithium hydroxide (1M)was added in portions while the reaction progress was monitored by TLC.Upon completion,an equimolar amount of aqueous hydrochloric acid (1M)was added and the volatiles evaporated.The mixture was diluted with water to about 50mL and the pH adjusted to 4?5.The mixture was then extracted with ethyl acetate (6×50mL).The combined organic fractions were dried over sodium sulfate and evaporated under reduced pressure,furnishing (2S ,4R )-1-(tert -butoxycarbonyl)-4-(nicotinamido)-pyrrolidine-2-carboxylic acid (498mg,1.485mmol,83%yield over steps 1and 2).

Step 3:(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihy-droisoxazol-5-yl)methyl)carbamoyl)-4-(nicotinamido)pyrrolidine-1-carboxylate.The Boc-protected amino acid thus obtained was used without further puri ?cation and elaborated to the ?nal inhibitor using the general procedure and puri ?ed by silica gel chromatography (80?100%ethyl acetate in pentane followed by 0?10%methanol in ethyl acetate),furnishing (2S ,4R )-quinolin-3-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)-4-(nicotinamido)-pyrrolidine-1-carboxylate (171mg,0.294mmol,19.8%yield over 3steps).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.98(dd,J =8.9,1.8Hz,1H),8.93and 8.85(2d,J =2.2Hz,1H),8.82(dd,J =12.4,6.8Hz,1H),8.72?8.68(m,1H),8.41and 8.35(2t,J =6.0Hz,1H),8.34and 8.26(2s,1H),8.16(ddt,J =10.1,8.0,2.0Hz,1H),8.03(d,J =8.4Hz,1H),7.96(ddd,J =8.0,6.2,1.4Hz,1H),7.77(ddd,J =8.4,6.8,1.4Hz,1H),7.63(dddd,J =8.1,6.2,4.7,1.2Hz,1H),7.50(dt,J =8.5,4.5Hz,1H),5.35?5.18(m,2H),4.77?4.69and 4.61?4.48(2m,2H),4.44and 4.35(2dd,J =8.2,5.5,8.4,4.9Hz,1H),3.86and 3.76(2dd,J =10.7,6.6Hz,1H),3.50?3.28(m,2H),3.28?3.12(m,2H),3.03and 2.95(2dd,J =17.6,7.3Hz,1H),2.29(ddt,J =27.8,12.7,7.6Hz,1H),2.07(tt,J =11.4,5.8Hz,1H).13C

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9059

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.37(d,J =41.8Hz),165.14(d,J =4.1Hz),153.76(d,J =32.7Hz),152.00,150.50(d,J =23.8Hz),148.54(d,J =4.0Hz),147.13(d,J =8.4Hz),138.09(d,J =32.9Hz),135.20(d,J =3.0Hz),134.44(d,J =54.0Hz),129.92(d,J =5.1Hz),129.72,129.64,128.78,128.07(d,J =10.8Hz),127.26(d,J =2.6Hz),126.98,123.42,80.08(d,J =17.9Hz),64.09(d,J =6.8Hz),58.69(d,J =70.1Hz),51.55(d,J =62.0Hz),48.20(d,J =75.0Hz),43.42,41.23(d,J =29.1Hz),36.20(d,J =140.7Hz).HRMS (ESI-QTOF)m /z :calculated for C 26H 27BrN 6O 52+[M +2H]2+,291.06077;found,291.06089.

(2S,4R)-Quinolin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)-4-(pyrazine-2-carboxamido)-pyrrolidine-1-carboxylate (9f ).Compound 9f was prepared analo-gously to compound 9a (3.6mg,6.18μmol,9.8%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ9.23(dd,J =8.8,5.0Hz,1H),9.18(dd,J =4.6,1.5Hz,1H),8.94and 8.86(2d,J =2.2Hz,1H),8.87(d,J =2.5Hz,1H),8.73(dd,J =2.5,1.5Hz,1H),8.61and 8.56(2t,J =6.0Hz,1H),8.37and 8.28(2d,J =2.1Hz,1H),8.03(dd,J =8.5,2.7Hz,1H),7.99(ddd,J =12.7,8.3,1.4Hz,1H),7.78(ddd,J =8.4,6.8,1.5Hz,1H),7.67?7.60(m,1H),5.37?5.19(m,2H),4.76?4.64and 4.60?4.52(2br m,2H),4.42and 4.34(2dd,J =9.0,4.0Hz,1H),3.85and 3.78(2dd,J =10.9,6.3Hz,1H),3.59?3.38(m,2H),3.31?3.08(m,2H),3.04?2.85(m,1H),2.67?2.53(m,1H), 1.93?1.82(m,1H).HRMS (ESI-QTOF)m /z :calculated for C 25H 25BrN 7O 5+[M +H]+,582.10951;found,582.11011.

1-(((3R,5S)-5-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)-carbamoyl)-1-((quinolin-3-ylmethoxy)carbonyl)pyrrolidin-3-yl)-carbamoyl)cyclobutanecarboxylic Acid,TFA Salt (9g ).The title compound was prepared analogously to compound 9a but with a 5-fold excess of all reagents relative to starting material 4d .The solvent was evaporated from the crude amide coupling mixture under vacuum and the residue directly puri ?ed by reverse-phase HPLC,furnishing 9g as its TFA salt (7.9mg,0.011mmol,17.5%yield).1H NMR (500MHz,DMSO-d 6)δ9.02?8.87(m,1H),8.58?8.33(m,2H),8.09?7.92(m,3H),7.87?7.79(m,1H),7.69(ddd,J =8.1,7.0,1.2Hz,1H),5.41?5.19(m,2H),4.80?4.66and 4.61?4.50(2br m,1H),4.44?4.17(m,2H),3.73(ddd,J =34.3,10.6,6.5Hz,1H),3.53?3.09(m,4H),2.96(ddd,J =39.5,17.5,7.5Hz,1H),2.81?2.70(m,1H),2.47?2.25(m,4H), 1.93?1.66(m,3H).HRMS (ESI-QTOF)m /z :calculated for C 26H 27BrN 5O 7[M ?H]?,600.10993;found,600.10961.

(S)-tert-Butyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)-carbamoyl)pyrrolidine-1-carboxylate (10a ).(S )-1-(tert -Butoxycarbonyl)pyrrolidine-2-carboxylic acid (2g,9.29mmol),HBTU (3.52g,9.29mmol),and 4-methylmorpholine (1.880g,18.58mmol)were dissolved in 20mL of DMF and stirred for 2min.Separately,(S )-(3-bromo-4,5-dihydroisoxazol-5-yl)methanamine (1.663g,9.29mmol)was diluted with 3mL of DMF and added to the reaction.The mixture was stirred for 30min before it was diluted with 100mL of saturated sodium bicarbonate solution and 100mL of water and then extracted with 250mL of ethyl acetate.The organic layer was washed with additional 200mL aliquots of saturated sodium bicarbonate solution,water,and brine,dried over sodium sulfate,and eventually evaporated to yield (S )-tert -butyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (3.373g,8.96mmol,96%yield)as a white solid.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.19and 8.10(2t,J =6.0Hz,1H),4.76?4.67(m,1H),4.09?4.01(m,1H),3.45?3.13(m,6H,partly obscured by residual water),3.02(ddd,J =17.6,7.4,3.6Hz,1H),2.15?2.01(m,1H),1.84?1.67(m,3H),1.39and 1.32(2s,9H).13

C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ173.22(d,J =41.3Hz),153.43(d,J =36.6Hz),138.16(d,J =16.9Hz),80.20,78.51(d,J =22.0Hz),59.62,46.56(d,J =25.9Hz),43.39(d,J =22.7Hz),41.00(d,J =77.0Hz),30.77(d,J =119.3Hz),28.10(d,J =15.6Hz),23.54(d,J =94.0Hz).HRMS (ESI-QTOF)m /z :calculated for C 14H 22BrN 3O 4Na +[M +Na]+,398.06859;found,398.06837.

(S)-N-(((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)pyrrolidine-2-carboxamide,TFA Salt (10a ′).An aliquot of the crude product

from 10a was then deprotected using neat TFA as described in step 2of the general procedure,but the deprotection mixture was poured into vigorously stirred cold diethyl ether.A sticky oil separated on the wall of the ?ask over the course of 1h.The liquids were decanted o ?,and the oil was washed with more diethyl ether.The oil was taken up in a little anhydrous methanol and the volatiles evaporated again and dried under high vacuum,furnishing an o ?-white foam that was used without puri ?cation.1H NMR (500MHz,DMSO-d 6)δ8.79(t,J =5.8Hz,1H),4.84?4.70(m,1H),4.17?4.10(m,1H),3.50?3.40(m,2H),3.38?3.15(m,3H,partly obscured by residual water),3.00(dd,J =17.6,7.2Hz,1H),2.33?2.22(m,1H),1.95?1.84(m,2H),1.83?1.74(m,1H).

To obtain the free base,a modi ?ed procedure deprotected 10a (3g,7.97mmol)in 25mL of TFA/DCM (3:2)for 1h,before diluting the mixture with water (60mL).The mixture was partitioned,the aqueous layer taken,and 10M sodium hydroxide carefully added until a pH of 12was reached,before it was extracted (4×50mL EtOAc).The combined extracts were dried over sodium sulfate and evaporated to furnish the deprotected amine in its free base as a viscous oil (1.3g,4.71mmol,59.0%yield)that was used without further puri ?cation.(S)-Prop-2-yn-1-yl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (10b ).10a ′(300mg,0.769mmol)and DMAP (19mg,0.16mmol)were dissolved in 4mL of anhydrous DMF and triethylamine (322μL,2.31mmol)was added,followed by propargyl chloroformate (182mg,1.54mmol).The mixture was stirred overnight and then diluted with 70mL of water and 70mL of ethyl acetate.The organic layer was washed with equal volumes of sodium bicarbonate twice,followed by brine,and then dried over sodium sulfate.The volatiles were evaporated and the crude product puri ?ed by preparative TLC,furnishing (S )-prop-2-yn-1-yl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)-pyrrolidine-1-carboxylate (79.7mg,0.223mmol,28.9%yield)as a colorless viscous oil that slowly solidi ?ed on standing.LC-MS analysis revealed that under the coupling conditions used herein,chloride had displaced bromide from the DHI moiety in about 13%of the puri ?ed product.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.24(dt,J =18.2,6.2Hz,1H),4.71(ddt,J =13.3,9.1,2.6Hz,1H),4.67?4.49(m,2H),4.15(ddd,J =8.6,5.4,3.5Hz,1H),3.54?3.16(m,6H,partly obscured by residual water),3.02(ddd,J =17.5,12.2,7.0Hz,1H),2.11(m,1H),1.91?1.67(m,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.57(d,J =12.1Hz),153.16(d,J =16.2Hz),138.10(d,J =6.3Hz),80.12(d,J =12.5Hz),79.19(d,J =4.3Hz),77.34(d,J =25.9Hz),59.76(d,J =79.2Hz),52.28(d,J =9.4Hz),46.86(d,J =83.4Hz),43.44(d,J =21.3Hz),41.12(d,J =21.3Hz),30.88(d,J =125.5Hz),23.47(d,J =115.3Hz).HRMS (ESI-QTOF)m /z :calculated for C 13H 17BrN 3O 4+[M +H]+,358.03970;found,358.03971.

(S)-Benzyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)-carbamoyl)pyrrolidine-1-carboxylate (10c ).Commercial (S )-1-((benzyloxy)carbonyl)pyrrolidine-2-carboxylic acid (418mg, 1.676mmol)was coupled to (S )-DHI (300mg,1.676mmol)analogously to step 1of the general procedure,furnishing the title compound in quantitative yield as a viscous oil which was su ?ciently pure as obtained from the extraction step.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.28and 8.22(2t,J =6.1Hz,1H),7.41?7.25(m,5H),5.12?4.96(m,2H),4.72and 6.63(2ddt,J =10.5,7.4,4.9Hz,1H),4.22and 4.16(2dd,J =8.5,3.1Hz,1H),3.51?3.15(m,5H,partly obscured by residual water),3.00(ddd,J =20.1,17.5,7.2Hz,1H),2.22?2.04(m,1H),1.89?1.71(m,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.85(d,J =27.8Hz),153.93(d,J =29.2Hz),138.09(d,J =17.4Hz),136.99,128.36(d,J =17.2Hz),127.72(d,J =25.1Hz),127.32(d,J =57.4Hz),80.15(d,J =13.4Hz),65.86(d,J =15.7Hz),59.74(d,J =79.0Hz),46.82(d,J =76.2Hz),43.39(d,J =8.7Hz),41.13(d,J =33.8Hz),30.92(d,J =134.0Hz),23.52(d,J =104.1Hz).HRMS (ESI-QTOF)m /z :calculated for C 17H 21BrN 3O 4+[M +H]+,410.07100;found,410.07074.

(S)-3-Fluorobenzyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (10d ).10a ′(150mg,0.384mmol)and DMAP (9.4mg,0.077mmol)were dissolved in 2.5

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9060

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

mL of anhydrous DMF,and triethylamine (53.6μL,0.384mmol)was added.Separately,3-?uorobenzyl 1H -imidazole-1-carboxylate (S3b )(85mg,0.384mmol)was dissolved in 1.25mL of anhydrous DCM.The two mixtures were combined and stirred overnight.DCM was then removed under reduced pressure and the residue diluted with 50mL of saturated sodium bicarbonate solution and extracted with 75mL of ethyl acetate.The organic layer was washed with more sodium bicarbonate (2×50mL),water (1×50mL),and brine (1×50mL),dried over sodium sulfate,and evaporated.The crude product was puri ?ed by preparative TLC in 70%ethyl acetate in pentane,furnishing (S )-3-?uorobenzyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate as a white solid.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.31and 8.22(2t,J =6.0Hz,1H),7.47?7.35(m,1H),7.23?7.08(m,3H),5.12?4.95(m,2H),4.75?4.61(m,1H),4.25and 4.16(2dd,J =8.5,3.1Hz,1H),3.54?3.26(m,4H,partly obscured by residual water),3.23?3.16(m,1H),3.00(ddd,J =17.6,15.1,7.2Hz,1H),2.23?2.05(m,1H),1.89?1.71(m,3H).HRMS (ESI-QTOF)m /z :calculated for C 17H 20BrFN 3O 4+[M +H]+,428.06157;found,428.06224.

(S)-4-Ethynylbenzyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (10e ).The title com-pound was prepared according to the published procedure.20HRMS (ESI-QTOF)m /z :calculated for C 19H 21BrN 3O 4+[M +H]+,434.07100;found,434.07073.

(S)-2,3-Dimethoxybenzyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10f ).The title compound was prepared analogously to compound 10d using 2,3-dimethoxybenzyl 1H -imidazole-1-carboxylate (S3c )as the carbamate precursor,furnishing a white foam (107.4mg,0.228mmol,59.4%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.26and 8.21(2t,J =6.0Hz,1H),7.09?6.98(m,2H),6.94and 6.85(2dd,J =7.4,1.8Hz,1H),5.11?4.97(m,2H),4.72and 4.60(2ddt,J =10.5,7.4,4.9Hz,1H),4.21and 4.16(2dd,J =8.3,3.0Hz,1H),3.81and 3.79(2s,3H),3.75and 3.71(2s,3H),3.50?3.13(m,5H,partly obscured by residual water),3.00(ddd,J =19.4,17.6,7.2Hz,1H),2.20?2.04(m,1H),1.87?1.70(m,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.80(d,J =15.2Hz),153.90(d,J =22.6Hz),152.22(d,J =17.1Hz),146.33(d,J =60.1Hz),138.05(d,J =18.4Hz),130.28(d,J =5.1Hz),124.00(d,J =10.3Hz),120.43(d,J =76.6Hz),112.65(d,J =44.3Hz),80.16(d,J =10.9Hz),61.37(d,J =33.1Hz),60.34(d,J =14.2Hz),59.71(d,J =77.2Hz),55.69(d,J =3.0Hz),46.81(d,J =80.7Hz),43.38(d,J =8.3Hz),41.11(d,J =28.0Hz),30.92(d,J =140.1Hz),23.48(d,J =111.6Hz).HRMS (ESI-QTOF)m /z :calculated for C 19H 25BrN 3O 6+[M +H]+,470.09212;found,470.09162.

(S)-3-(Benzyloxy)benzyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10g ).The title compound was prepared analogously to compound 10d using 3-(benzyloxy)benzyl 1H -imidazole-1-carboxylate (S3d )as the carbamate precursor,furnishing a white foam (121.6mg,0.235mmol,61.2%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.29and 8.22(2t,J =6.1Hz,1H),7.48?7.43(m,2H),7.42?7.37(m,2H),7.36?7.31(m,1H),7.30?7.22(m,1H),7.02?6.84(m,3H),5.14?4.92(m,4H),4.76?4.68and 4.64?4.57(2m,1H),4.23and 4.16(2dd,J =8.5,3.1Hz,1H),3.51?3.13(m,5H,partly obscured by residual water),2.98(ddd,J =34.8,17.6,7.2Hz,1H),2.22?2.05(m,1H),1.90?1.71(m,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.85(d,J =30.4Hz),158.38,153.86(d,J =29.3Hz),138.62(d,J =5.6Hz),138.05(d,J =22.9Hz),137.06(d,J =3.4Hz),129.49(d,J =17.2Hz),128.47,127.87(d,J =4.3Hz),127.75(d,J =7.6Hz),119.49(d,J =53.8Hz),113.90(d,J =48.2Hz),113.53(d,J =12.4Hz),80.13(d,J =16.2Hz),69.16(d,J =4.5Hz),65.63(d,J =18.3Hz),59.73(d,J =74.9Hz),46.82(d,J =78.5Hz),43.37(d,J =5.2Hz),41.15(d,J =29.4Hz),30.94(d,J =136.3Hz),23.51(d,J =103.7Hz).HRMS (ESI-QTOF)m /z :calculated for C 24H 27BrN 3O 5+[M +H]+,516.11286;found,516.11274.

(S)-Pyridin-2-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (10h ).The title com-pound was prepared analogously to compound 10d using pyridin-2-ylmethyl 1H -imidazole-1-carboxylate (S3e )as the carbamate precursor

and puri ?ed by pTLC (100%ethyl acetate,developed twice),furnishing a white solid (72mg,0.175mmol,45.5%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.54and 8.50(2d,J =4.2Hz,1H),8.34and 8.22(2t,J =6.1Hz,1H),7.85?7.77(m,1H),7.43?7.28(m,2H),5.16?5.01(m,2H),4.75?4.63(m,1H),4.30and 4.17(dd,J =8.5,3.1Hz,1H),3.59?3.16(m,5H,partly obscured by residual water),3.00(dt,J =17.5,7.2Hz,1H),2.23?2.08(m,1H),1.92?1.74(m,3H).HRMS (ESI-QTOF)m /z :calculated for C 16H 20BrN 4O 4+[M +H]+,411.06624;found,411.06594.

(S)-Pyridin-3-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (10i ).The title com-pound was prepared analogously to compound 10d using pyridin-3-ylmethyl 1H -imidazole-1-carboxylate (S3f )as the carbamate precursor and puri ?ed by pTLC (100%ethyl acetate,developed twice),furnishing a white solid (38mg,0.092mmol,24.0%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.62?8.47(m,2H),8.28and 8.22(2t,J =6.0Hz,1H),7.79and 7.69(2dt,J =8.0,2.0Hz,1H),7.44?7.35(m,1H),5.14?4.98(m,2H),4.75?4.68and 4.67?4.61(2m,1H),4.22and 4.16(2dd,J =8.6,3.3Hz,1H),3.53?3.26(m,4H,partly obscured by residual water),3.24?3.13(m,1H),2.99(td,J =17.6,7.2Hz,1H),2.21?2.06(m,1H),1.88?1.70(m,3H).

(S)-Pyridin-4-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (10j ).The title com-pound was prepared analogously to compound 10d using pyridin-4-ylmethyl 1H -imidazole-1-carboxylate (S3g )as the carbamate precursor and puri ?ed by pTLC (100%ethyl acetate,developed twice),furnishing a white solid (67mg,0.163mmol,42.4%yield).1H NMR (400MHz,DMSO-d 6,mixture of rotational isomers)δ8.54(ddd,J =12.0,4.6,1.5Hz,2H),8.37and 8.24(2t,J =6.0Hz,1H),7.35and 7.27(2d,J =5.2Hz,2H),5.25?5.00(m,2H),4.77?4.64(m,1H),4.30and 4.17(2dd,J =8.3,3.1Hz,1H),3.60?3.15(m,5H),3.00(ddd,J =17.6,7.2,4.6Hz,1H),2.24?2.06(m,1H),1.92?1.70(m,3H).

(S)-Quinolin-4-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10k ).10a ′(241mg,0.617mmol)was dissolved in 2mL of DMF and N -methylmorpholine (203μL,1.850mmol)was added,followed by solid 4-nitrophenyl (quinolin-4-ylmethyl)carbonate (S4b ,100mg,0.308mmol).The mixture was stirred at room temperature for 22h and then diluted with 40mL of water and extracted with 60mL of ethyl acetate.The organic layer was washed with additional water (2×40mL),dilute aqueous potassium carbonate (2×40mL),and brine (1×40mL),dried over sodium sulfate,and eventually evaporated.The residue was purifed by pTLC (2mm plate thickness and developed in 100%ethyl acetate,R f approximately 0.2),furnishing (S )-quinolin-4-ylmethyl 2-((((S )-3-bromo-4,5-dihydroisoxazol-5-yl)-methyl)carbamoyl)pyrrolidine-1-carboxylate (44.2mg,0.096mmol,31.1%yield)as a light-orange oil.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.90and 8.87(2d,J =4.4Hz,1H),8.35and 8.25(2t,J =6.0Hz,1H),8.12?7.98(m,2H),7.83?7.77(m,1H),7.66(m,1H),7.53and 7.45(2d,J =4.4Hz,1H),5.68?5.50(m,2H),4.72and 4.62(2ddt,J =10.4,7.4,5.0Hz,1H),4.32and 4.20(2dd,J =8.5,3.0Hz,1H),3.61?3.14(m,5H,partly obscured by residual water),3.00(td,J =17.7,7.2Hz,1H),2.23?2.09(m,1H),1.90?1.74(m,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.73(d,J =34.3Hz),153.52(d,J =27.7Hz),150.34(d,J =13.3Hz),147.39(d,J =14.4Hz),142.32,138.05(d,J =19.8Hz),129.54(d,J =9.4Hz),129.46,126.89(d,J =8.0Hz),125.21(d,J =20.3Hz),123.60(d,J =9.0Hz),118.83(d,J =41.4Hz),80.14(d,J =10.5Hz),62.72,59.79(d,J =86.0Hz),46.94(d,J =83.2Hz),43.37(d,J =6.7Hz),41.18(d,J =34.0Hz),30.97(d,J =144.3Hz),23.49(d,J =105.2Hz).HRMS (ESI-QTOF)m /z :calculated for C 20H 22BrN 4O 4+[M +H]+,461.08189;found,461.08155.

(S)-Quinoxalin-2-ylmethyl 2-((((S)-3-Bromo-4,5-dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10l ).Compound 10l was prepared from 4-nitrophenyl (quinoxalin-2-ylmethyl)carbonate (S4c )by the procedure of compound 10k and puri ?ed by pTLC (2mm plate thickness and developed in 100%ethyl acetate,R f

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9061

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

approximately 0.35),furnishing the title compound as a colorless oil (29.8mg,0.064mmol,41.9%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ9.02and 8.90(2s,1H),8.34and 8.24(2t,J =6.0Hz,1H),8.16?8.03(m,2H),7.92?7.83(m,2H),5.44?5.25(m,2H),4.71and 4.63(2ddt,J =10.2,7.2,5.0Hz,1H),4.33and 4.18(2dd,J =8.4,3.2Hz,1H),3.61?3.26(m,4H,partly obscured by residual water),3.25?3.16(m,1H),2.99(ddd,J =17.5,12.3,7.2Hz,1H),2.25?2.09(m,1H),1.92?1.74(m,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.70(d,J =43.0Hz),153.62(d,J =35.7Hz),152.37,144.44(d,J =16.1Hz),141.31(d,J =4.7Hz),140.85(d,J =13.9Hz),137.99(d,J =28.9Hz),130.60(d,J =6.4Hz),130.16(d,J =9.0Hz),128.98,128.79(d,J =8.5Hz),80.08(d,J =15.3Hz),65.68(d,J =9.5Hz),59.87(d,J =77.5Hz),46.96(d,J =74.0Hz),43.38,41.18(d,J =26.1Hz),30.94(d,J =129.8Hz),23.54(d,J =103.8Hz).HRMS (ESI-QTOF)m /z :calculated for C 19H 21BrN 5O 4+[M +H]+,462.07714;found,462.07761.

(S)-(S)-1-(Naphthalen-2-yl)ethyl 2-((((S)-3-Bromo-4,5-dihydroi-soxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10m ).(S )-1-(Naphthalen-2-yl)ethyl 1H -imidazole-1-carboxylate (S3h )was elaborated to the ?nal inhibitor adapting the procedure for 10d ,furnishing the title compound in 32.1%yield (58.5mg,0.123mmol).1

H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.35and 8.18(2t,J =6.0Hz,1H),7.96?7.77(m,4H),7.56?7.40(m,3H),5.89?5.77(m,1H),4.73and 4.56(2ddt,J =10.2,7.3,4.9Hz,1H),4.33and 4.08(2dd,J =8.7,3.1Hz,1H),3.61?3.34and 3.30?3.07(2m,5H),3.03and 2.93(dd,J =17.6,7.3Hz,1H),2.24?2.15and 2.11?2.02(2m,1H),1.92?1.70(m,3H),1.56and 1.50(2d,J =6.6Hz,3H).HRMS (ESI-QTOF)m /z :calculated for C 22H 24BrN 3O 4Na +[M +Na]+,496.08424;found,496.08369.

(S)-(R)-1-(Naphthalen-2-yl)ethyl 2-((((S)-3-Bromo-4,5-dihydroi-soxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10n ).(R )-1-(Naphthalen-2-yl)ethyl 1H -imidazole-1-carboxylate (S3i )was elaborated to the ?nal inhibitor adapting the procedure for 10d ,furnishing the title compound in 27.6%yield (50.3mg,0.106mmol).1

H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.43and 8.17(2t,J =6.0Hz,1H),7.95?7.82(m,4H),7.57?7.47(m,3H),5.88?5.78(m,1H),4.83?4.74and 4.70?4.62(2m,1H),4.29and 4.18(2dd,J =8.3,3.4Hz,1H),3.58?3.25and 3.16?3.11(2m,5H,partly obscured by residual water),3.07and 2.95(2dd,J =17.6,7.1Hz,1H),2.22?2.07(m,1H),1.91?1.71(m,3H),1.54and 1.43(2d,J = 6.5Hz,3H).HRMS (ESI-QTOF)m /z :calculated for C 22H 24BrN 3O 4Na +[M +Na]+,496.08424;found,496.08395.

(S)-(R)-1-(Quinolin-3-yl)ethyl 2-((((S)-3-Bromo-4,5-dihydroisoxa-zol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate (10o ).1-(Qui-nolin-3-yl)ethanone was asymmetrically reduced by a low temperature variation of the CBS reaction.60,61Thus,the ketone substrate (200mg,1.17mmol)and (S )-1-methyl-3,3-diphenylhexahydropyrrolo[1,2-c ]-[1,3,2]oxazaborole (32.4mg,0.117mmol)were dissolved in 10mL of anhydrous toluene and cooled to ?78°C.Catecholborane (250μL,2.34mmol)was added in a dropwise fashion and the mixture stirred until TLC showed full consumption of the starting material.A few drops of water were added and the mixture allowed to reach room temperature.Ethyl acetate (50mL)was added and the mixture washed with sodium bicarbonate followed by brine (50mL each).The organic layer was dried over sodium sulfate,evaporated,and the (R )-1-(quinolin-3-yl)ethanol enriched by a brief puri ?cation by preparative TLC.The alcohol was dissolved in dry acetonitrile (5mL),and 1,1′-carbonyldiimidazole (169mg, 1.039mmol)was added and the mixture stirred for 30min.The solvent was then evaporated and the crude residue taken up in ethyl acetate (50mL)and washed with sodium bicarbonate and brine and dried over sodium sulfate.The volatiles were evaporated and the crude product puri ?ed by preparative TLC,furnishing (R )-1-(quinolin-3-yl)ethyl 1H -imidazole-1-carboxylate (154mg,0.576mmol,49.3%yield over two steps)as a yellowish solid.An aliquot of the carbamate building block (70mg,0.262mmol)was elaborated to the ?nal inhibitor using the procedure of 10d and puri ?ed by preparative TLC to a ?ord a white solid (38.7mg,0.081mmol,31.1%yield).1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.96and 8.92(2d,J =2.2Hz,1H),8.44and 8.18(2t,J =6.0Hz,1H),8.33and 8.28(2d,J =2.2Hz,

1H),8.05?7.98(m,2H),7.76(ddd,J =8.4,7.0,1.3Hz,1H),7.63(ddd,J =8.0,6.8,1.3Hz,1H),5.96?5.85(m,1H),4.83?4.73and 4.70?4.60(2m,1H),4.29and 4.18(2dd,J =8.3,3.5Hz,1H),3.62?3.23and 3.15?3.09(2m,5H,partially obscured by residual water),3.06and 2.94(2dd,J =17.5,7.1Hz,1H),2.23?2.08(m,1H),1.90?1.72(m,3H),1.60and 1.48(2d,J =6.6Hz,3H).13C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.91(d,J =67.7Hz),153.27(d,J =41.2Hz),149.31,147.08,138.06(d,J =7.9Hz),135.13(d,J =14.6Hz),132.29(d,J =8.0Hz),129.50,128.70(d,J =3.6Hz),128.18,127.31,126.88(d,J =2.9Hz),80.15(d,J =10.1Hz),70.39,59.72(d,J =65.9Hz),46.77(d,J =50.7Hz),43.43(d,J =26.7Hz),41.27(d,J =64.9Hz),30.85(d,J =108.0Hz),23.54(d,J =85.9Hz),22.40(d,J =12.4Hz).HRMS (ESI-QTOF)m /z :calculated for C 21H 24BrN 4O 4+[M +H]+,475.09754;found,475.09802.

(S)-(1H-Benzo[d]imidazol-2-yl)methyl 2-((((S)-3-Bromo-4,5-dihy-droisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxylate,TFA Salt (10p ).(1H -Benzo[d ]imidazol-2-yl)methanol (62.7mg,0.423mmol)and 1,1′-carbonyldiimidazole (68.6mg,0.423mmol)were dissolved in 3mL of anhydrous acetonitrile/DCM (1:1)and stirred for 15min.The solvent was then evaporated under reduced pressure at room temperature and the residue suspended in 1mL of anhydrous DCM.A mixture of 10a ′(150mg,0.38mmol),triethylamine (54μL,0.38mmol),and DMAP (4.70mg,0.038mmol)in 2mL of anhydrous DMF was then added and stirred overnight.All volatiles were subsequently removed under high vacuum,furnishing a yellow residue.An aliquot of this residue was puri ?ed by reverse-phase HPLC,furnishing the title compound as a TFA salt.1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.32and 8.27(2t,J =6.0Hz,1H),7.77(ddd,J =9.3,6.1,3.2Hz,2H),7.50?7.44(m,2H),5.58?5.31(m,2H),4.70and 4.62(2ddt,J =10.5,7.2,5.0Hz,1H),4.37and 4.18(2dd,J =8.5,3.4Hz,1H),3.60?3.15(m,5H),2.98(ddd,J =17.6,7.1,4.8Hz,1H),2.13(m,1H),1.91?1.73(m,3H).13

C NMR (126MHz,DMSO-d 6,mixture of rotational isomers)δ172.40(d,J =32.0Hz),153.11,149.57(d,J =19.4Hz),138.02(d,J =16.1Hz),132.95(d,J =21.1Hz),124.98(d,J =11.9Hz),114.53,80.04(d,J =18.0Hz),59.94(d,J =67.8Hz),57.91(d,J =27.2Hz),47.05(d,J =79.0Hz),43.40,41.28(d,J =27.5Hz),30.92(d,J =106.0Hz),23.47(d,J =114.5Hz).HRMS (ESI-QTOF)m /z :calculated for C 18H 21BrN 5O 4+[M +H]+,450.07714;found,450.07700.

(S)-(1-Methyl-1H-benzo[d]imidazol-2-yl)methyl 2-((((S)-3-Bromo-4,5-dihydro-isoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-carboxy-late,TFA Salt (10q ).(1H -Benzo[d ]imidazol-2-yl)methanol (300mg,2.025mmol)was methylated with methyl iodide following the procedure of Popov,furnishing (1-methyl-1H -benzo[d ]imidazol-2-yl)methanol (205mg,1.264mmol,62.4%yield)as a white solid by ?ltration.621H NMR (400MHz,DMSO-d 6)δ7.58(dt,J =7.8,1.0Hz,1H),7.52(dt,J =8.2,1.0Hz,1H),7.24(ddd,J =8.0,7.1,1.3Hz,1H),7.17(ddd,J =8.2,7.2,1.3Hz,1H),5.58(br s,1H),4.71(s,2H),3.82(s,3H).An aliquot of this solid was reacted with 1,1′-carbonyldiimidazole and in situ coupled to 10a ′as described for compound 10p .1H NMR (500MHz,DMSO-d 6,mixture of rotational isomers)δ8.28(dt,J =16.3,6.1Hz,1H),7.84(dd,J =11.6,8.1Hz,1H),7.77(dd,J =11.5,8.0Hz,1H),7.54?7.43(m,2H),5.58?5.34(m,2H),4.70and 4.48(2ddt,J =10.4,7.2,5.0Hz,1H),4.26and 4.17(2dd,J =8.4,3.1Hz,1H),3.97and 3.90(2s,3H),3.56?3.31(m,3H),3.27?3.10(m,2H),2.95(ddd,J =35.8,17.6,7.1Hz,1H),2.22?2.06(m,1H), 1.92?1.70(m,3H).HRMS (ESI-QTOF)m /z :calculated for C 19H 23BrN 5O 4+[M +H]+,464.09279;found,464.09276.

■

ASSOCIATED CONTENT

*

Supporting Information Potency and selectivity of hydroxy-proline and prolyl amide inhibitors.Additional synthetic methods and supplemental compound characterization data (NMR and LC-MS).This material is available free of charge via the Internet at 54f171090975f46526d3e14f.

54f171090975f46526d3e14f/10.1021/jm501145a |J.Med.Chem.2014,57,9042?9064

9062

D o w n l o a d e d b y N A N J I N G U N I V O F T

E C H N O L O G Y o n A u g u s t 26, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): O c t o b e r 31, 2014 | d o i : 10.1021/j m 501145a

本文来源：https://www.bwwdw.com/article/ougq.html