Caught red-handed Rc encodes a basic helix-loop-helix protein conditioning red pericarp in rice

RESEARCH ARTICLES

Caught Red-Handed:Rc Encodes a Basic Helix-Loop-Helix Protein Conditioning Red Pericarp in Rice W OA

Megan T.Sweeney,a Michael J.Thomson,a,1Bernard E.Pfeil,b and Susan McCouch a,2

a Department of Plant Breeding and Genetics,Cornell University,Ithaca,New York14953-1901

b Department of Plant Biology,Cornell University,Ithaca,New York14853

Rc is a domestication-related gene required for red pericarp in rice(Oryza sativa).The red grain color is ubiquitous among the wild ancestors of O.sativa,in which it is closely associated with seed shattering and dormancy.Rc encodes a basic helix-loop-helix(bHLH)protein that was?ne-mapped to an18.5-kb region on rice chromosome7using a cross between Oryza ru?pogon(red pericarp)and O.sativa cv Jefferson(white pericarp).Sequencing of the alleles from both mapping parents as well as from two independent genetic stocks of Rc revealed that the dominant red allele differed from the recessive white allele by a14-bp deletion within exon6that knocked out the bHLH domain of the protein.A premature stop codon was identi?ed in the second mutant stock that had a light red pericarp.RT-PCR experiments con?rmed that the Rc gene was expressed in both red-and white-grained rice but that a shortened transcript was present in white varieties. Phylogenetic analysis,supported by comparative mapping in rice and maize(Zea mays),showed that Rc,a positive regulator of proanthocyanidin,is orthologous with INTENSIFIER1,a negative regulator of anthocyanin production in maize, and is not in the same clade as rice bHLH anthocyanin regulators.

INTRODUCTION

Most rice(Oryza sativa)that is grown and consumed throughout the world has white pericarp,but rice can also produce grains with brown,red,and purple pericarp.The color is visible when the grains are dehulled,but it can be removed by polishing to reveal the white endosperm.Red pericarp is ubiquitous among the wild ancestors of cultivated rice(Oryza ru?pogon),and in some regions of the world red cultivars are preferred for their taste,texture,and ceremonial or medicinal value.Consumer interest in red and purple rices represents a growing specialty market in the United States,but at the same time,the constant presence of weedy red rice in farmers’?elds is the most eco-nomically important pest and grain-quality problem faced by U.S.rice growers(Gealy et al.,2002).Red rices,which typically show seed shattering and dormancy along with a red pericarp, can belong to either O.sativa or O.ru?pogon(Vaughan et al., 2001),neither of which is native to the United States.They interbreed freely with cultivated,white-grained types,making transgenic herbicide-resistant varieties impractical.

The red pigment in rice grains is proanthocyanidin,also called condensed tannins(Oki et al.,2002).Proanthocyanidins are a branch off the anthocyanin pathway and share many of the same biosynthetic genes(Winkel-Shirley,2001).Proanthocyanidins have been shown to have important deterrent effects on path-ogens and predators,so it is not surprising that spontaneous mutations that inhibit pigment production would be selected against in the wild(Shirley,1998).On the other hand,white grain appears to be associated with the domestication syndrome and remains under strong selection in most rice breeding programs today.

Regardless of the problems associated with red rice as a weed,the red pigment is of interest for nutritional reasons.It serves as a powerful antioxidant that has been demonstrated to reduce atherosclerotic plaque formation,a risk factor associated with cardiovascular disease(Ling et al.,2001).On the negative side,proanthocyanidin pigments reduce the bioavailability of iron,protein,and carbohydrates(Eggum et al.,1981;Carmona et al.,1996;Glahn et al.,2002),which has important implications for people with low nutritional status.A better understanding of the genetics and molecular biology of red pericarp and the association of this characteristic with other wild/weedy traits will provide important information for the better management of both the negative and positive features associated with red rice. Two loci have been identi?ed using classical genetic analysis, Rc(brown pericarp and seed coat)and Rd(red pericarp and seed coat).When present together,these loci produce red seed color (Kato and Ishikawa,1921).Rc in the absence of Rd produces

1Current address:Department of Plant Breeding,Genetics,and

Biotechnology,International Rice Research Institute,Los Ban?os,

Laguna,Philippines.

2To whom correspondence should be addressed.E-mail srm4@

cornell.edu;fax607-255-6683.

The author responsible for distribution of materials integral to the

?ndings presented in this article in accordance with the policy described

in the Instructions for Authors()is:Susan R.McCouch

(srm4@cornell.edu).

W Online version contains Web-only data.

OA Open Access articles can be viewed online without a subscription.

Article,publication date,and citation information can be found at

/cgi/doi/10.1105/tpc.105.038430.

The Plant Cell,Vol.18,283–294,February2006,ª2006American Society of Plant Biologists

brown seeds,whereas Rd alone has no phenotype (Figure 1A).

There are three known alleles of Rc :Rc ,which exhibits brown

spots on a reddish-brown background;Rc-s ,which produces

a light red color;and rc (historically,Rc þ),which is a null

allele.Although Rc is referred to as a mutant allele because its

phenotype differs from that of common rice cultivars,the action

of Rc is dominant over white pericarp (rc ).This suggests that the

modern cultivated (white)allele might actually be the mutant

(nonfunctional)version of the ancestral O.ru?pogon (red)allele.Both loci have been mapped using standard two-point analysis on the morphological map of rice:Rc on chromosome 7and Rd on chromosome 1.Proanthocyanidin biosynthesis is a branch of the anthocyanin biosynthetic pathway,a well-studied system in multiple species as a result of its visible phenotype and lack of detrimental effects on the plant.These pathways are regulated by homologs with similar functions in different species.The ?rst gene is a R2R3Myb homolog that contains an acidic activation domain in the

C Figure 1.Phenotypes and Fine-Mapping of Rc.

(A)Rc allele phenotypes.Top row,left to right:seeds from cv Jefferson and O.ru?pogon ;bottom row,left to right:seeds from Surjamkuhi and H75.

(B)Fine mapping.(i)QTL log of the odds (LOD)plot (y axis)and marker order (x axis).The black oval indicates the position of the centromere;Rc indicates the map position of Rc.(ii)Progress made narrowing the QTL by generation.(iii)Scheme of genotypes for three recombinant classes.Black bars represent DNA from the O.ru?pogon parent,white bars represent DNA from the cv Jefferson parent,and gray bars represent an interval containing a break point between cv Jefferson and O.ru?pogon DNA.White or red indicates the color of the pericarp conditioned by each class.The ruler shows where the markers and break points are positioned along the psuedomolecule for chromosome 7,and the numbers indicate megabase pairs.Markers that bracket or are included in the 18.5-kb target region are shown in red.The Institute for Genomic Research (TIGR)gene models are shown below the ruler,and numbers indicate the last digits of the gene identi?ers,where all begin with LOC_Os07g11_.Transposable elements (TEs)are shown in green.Alternative splice variants are indicated by gene names ending with.1and.2.The last four genes are staggered for clarity of presentation.(iv)The bHLH gene model,predicted from the O.ru?pogon sequence,is enlarged to show the location of intragenic markers (indicated with arrows).The bHLH domain is indicated by black boxes at the end of exon 6and the beginning of exon 7.

284The Plant Cell

terminus.Myb domains exhibit DNA binding ability and function in protein–protein interactions.These proteins are encoded by the PURPLE PLANT1/COLORED ALEURONE1(Pl1/C1)genes in maize(Zea mays),by the ANTHOCYANIN2(AN2)and AN4genes in petunia(Petunia hybrida)(Spelt et al.,2000),and by the TRANSPARENT TESTA2(TT2)gene in Arabidopsis thaliana(Nesi et al.,2001).

The Myb proteins have been shown to interact with a basic helix-loop-helix(bHLH)protein in each of the three model sys-tems.In Arabidopsis,TT8encodes a bHLH protein(Baudry et al., 2004),whereas petunia has two bHLH proteins involved in anthocyanin regulation,AN1and JAF13(Spelt et al.,2000).In maize,several genes belonging to the RED/BOOSTER(R1/B1) families encode these proteins(Goff et al.,1992).These genes have different tissue speci?cities and exhibit no activation do-mains or DNA binding activity alone(Goff et al.,1992).Recent experiments in maize suggest that R functions in part to free C1 from interaction with a repressor protein as well as to recognize R-speci?c anthocyanin promoter elements(Hernandez et al., 2004).Maize also contains a bHLH protein,INTENSIFIER1(In1), whose dominant allele acts as a negative regulator of pigmen-tation(Burr et al.,1996).

In the vegetative tissue of maize,only one member from each of the Myb and bHLH families has been shown to be required for pigmentation.However,in petunia,Arabidopsis,and maize seeds,genes encoding a WD40protein are also required for the expression of anthocyanin biosynthetic genes.These proteins are encoded by the TRANSPARENT TESTA GLABRA1gene in Arabidopsis,by AN11in petunia,and by PALE ALEURONE COLOR1in maize(de Vetten et al.,1997;Baudry et al.,2004; Carey et al.,2004).They have been shown to physically interact with the bHLH protein in petunia and Arabidopsis(Walker et al., 1997;Sompornpailin et al.,2002).In petunia and Arabidopsis, other regulatory factors,such as TT1,a zinc?nger protein (Sagasser et al.,2002),and ANTHOCYANINLESS2,a homeo-domain protein(Kubo et al.,1999),have also been described where loss of function results in a complete lack of pigmentation. In addition to being constitutively expressed,anthocyanin and proanthocyanidins can be induced by stresses,including cold, drought,and UV light.The regulatory elements that control these processes are only beginning to be understood.Recent studies have found that the basic domain/leucine zipper family of tran-scription factors,together with the Myb genes,play a role in induced expression(Ithal and Reddy,2004;Hartmann et al.,2005). We report here the cloning of a bHLH gene underlying a quantitative trait locus(QTL)for rice pericarp color.The QTL colocalizes with the mutant Rc.A frame shift deletion before the bHLH domain results in a knockout of proanthocyanidin pro-duction,leading to white rice.

RESULTS

Rough Mapping of QTLs and the Rc Mutant

Previous QTL mapping in this laboratory identi?ed a single, signi?cant QTL associated with red grain(rg7.1)on chromosome 7(Figure1B,i).This QTL was identi?ed in two independent BC2populations derived from crosses between an accession of O.ru?pogon(IRGC-105491)from Malaysia and,in one case,a U.S.tropical japonica cultivar,Jefferson,and in the other case,a widely planted tropical indica cultivar,IR64.The log of the odds scores associated with the rg7.1QTL peaks in these two populations were99and33,respectively,and the QTL was detected in multiple environments(Septiningsih et al.,2003).The peak of both QTLs corresponded to the previously mapped position of the mutant locus,brown pericarp,Rc(Kinoshita, 1998).All of the BC2F1plants had red seeds,indicating that the rg7.1locus is dominant for red color,with the dominant allele donated by the O.ru?pogon ing the cv Jefferson/ O.ru?pogon population,rg7.1encompassed a5.1-centimorgan (cM)region that represented;7.2Mb straddling the border of the centromere on chromosome7(Figure1B,i).The genetic/ physical distance in this region averages1.4Mb/cM,much above the genome average of200to250kb/cM,as expected for a pericentromeric region(Zhao et al.,2002;Wu et al.,2003).An investigation of the genotype–phenotype relationship in285 BC2F2families demonstrated that all18families with red grain contained the O.ru?pogon allele at either RM125or the adjacent marker,RG30,suggesting that the gene underlying rg7.1lay between these two markers.

Fine-Mapping of rg7.1

To?ne-map the gene,1410BC2F3plants were genotyped using markers?anking the QTL.The72recombinant plants were genotyped using six markers within the QTL region to locate the recombination break points more precisely,and the seed color of each recombinant line was recorded.Nineteen new simple-sequence repeat(SSR)and insertion/deletion(indel)markers were developed to help de?ne break points across the region (see Supplemental Table1online).To narrow the region respon-sible for rg7.1in each successive generation,we determined which segments of DNA from the red donor parent,O.ru?pogon, were shared in all red-seeded progeny and eliminated from further consideration the O.ru?pogon segments that appeared in white-seeded progeny.Because the trait is dominant,both the heterozygous and the homozygous O.ru?pogon classes had identical phenotypes and therefore were grouped together dur-ing?ne-mapping.

In the?nal BC2F6generation,4000plants were genotyped and three classes of informative recombinants were identi?ed, which narrowed the rg7.1QTL to an18.5-kb region(Figure1B, iii).Class1consisted of a single plant with a break point de?ned by markers RID13and RM21197,located between the?rst and second exons of the gene LOC_Os07g11020.1,as illustrated in panel iv of Figure1B.Upstream of RID13,these plants inherited O.ru?pogon DNA,and downstream of RM21197,they were homozygous for cv Jefferson alleles,with the break point delimited to the region between the two markers.Because these plants had white seeds,we concluded that rg7.1could not be located in the region upstream of RID13,which was heterozy-gous for O.ru?pogon DNA.Recombinant class2consisted of22 individuals having recombination break points between RID14 and RID15.This14-kb region was highly repetitive,precluding the development of additional markers to help resolve the

Rc Encodes bHLH Protein Red Rice285

precise position of each break point.All plants in this class had red pericarp,and because they were all homozygous for cv Jefferson DNA downstream of RID15,we were able to eliminate that region as the location of rg7.1.Class3consisted of a single red-seeded recombinant plant that contained an intragenic break point between RM21197and RID12.It had cv Jefferson DNA upstream of RM21197,allowing us to eliminate the region between RID13and RM21197from further consideration.We thus de?ned an18.5-kb target region for rg7.1bracketed by RM21197and RID15(Figure1B,iii).

Physical/Genetic Distance

The evaluation of4000plants for recombination allowed us to identify recombinational hot and cold spots within the401-kb region.The most recombinagenic interval was a6-kb region that contained no annotated gene models,de?ned by markers RID16 and RID17(Figure2).Within this interval,the physical/genetic distance was4kb/cM,a recombination rate signi?cantly higher than the average across the401-kb region(P<0.001).The4-kb interval just downstream(RID17to RID18)also lacked gene models but had no detectable recombination.The second most recombinagenic region(12.3kb/cM;P<0.001)was the14-kb interval between RID14and RID15that contained two TEs. Again,this region was juxtaposed with a2.3-kb region upstream in which there was no detectable recombination.The large interval between RM21177and RM21194(;300kb),with50 annotated gene models only3of which are TEs,had a recom-bination rate signi?cantly lower than the average for the region (P<0.001),even after recombination rates from the two hot spots were excluded from the average(Figure2).

Positional and Functional Candidate Genes

One non-TE gene was detected within the18.5-kb target region. LOC_Os07g11020.1is a single-copy gene668amino acids in length and containing a predicted bHLH domain.This domain is common among transcription factors known to regulate

pigment

Figure2.Physical/Genetic Distance around the Rc Locus.

Graph showing recombination rates across the410-kb region examined in the BC2F6generation of?ne-mapping.The x axis is positioned along the psuedomolecule,and the y axis shows the number of recombination events per100plants.Physical/genetic distance is given in kb/cM above each interval.TIGR gene models are shown above the marker designations,with TEs in gray.Gene models are ordered as in Figure1.Intervals indicated by asterisks have recombination rates signi?cantly different from the average at the5%level after Bonferroni correction;those indicated by double asterisks are signi?cant at0.1%.

286The Plant Cell

synthesis.As illustrated in Figure1B,panel iv,a recombination break point between RM21197and RID12in recombinant class3 had eliminated the promoter region and the?rst two exons of the bHLH gene as the source of the functional nucleotide poly-morphism,leaving only exons3to7within the18.5-kb target region.In addition to the bHLH protein,two putative transposon proteins,LOC_Os07g11040.1and LOC_Os07g11030.1,both of the CACTA type,En/Spm subclass,were also present within the 18.5-kb target region.These were eliminated from further consid-eration based on three lines of evidence.First,the sequences of both of these proteins have>100BLAST hits in the rice genome, with>98%identity over the entire length of the sequences. Mutations in either of these highly repeated genes would have no phenotypic consequences,because many other copies would remain functional in the genome.Second,domain analysis showed that LOC_Os07g11040.1contains a transposase domain and LOC_Os07g11030.1contains a proteinase domain,neither of which has been found in any of the regulatory or biosynthetic proteins responsible for anthocyanin/proanthocyanidin pigmen-tation in plants.Third,although TEs can be responsible for phenotypic changes if they are inserted within functional genes, neither of the two TEs within the rg7.1QTL region shows any evidence of having disrupted any other genes.Therefore,based on our positional analysis and in silico functional interpretation,we postulated that the bHLH gene was responsible for red pericarp at the rg7.1locus.We proceeded to test this hypothesis using three additional lines of evidence:sequence comparison of parental lines,sequence comparison of an allelic series,and expression analysis of the bHLH gene.

Sequence Comparison of the bHLH Gene

We sequenced the bHLH locus in both mapping parents, O.sativa(cv Jefferson)and O.ru?pogon,to search for sequence changes that could explain the observed change in pericarp color.Having eliminated the promoter of the bHLH gene through recombination,we focused on changes that could affect the protein sequence.Six indels and22single-nucleotide polymor-phisms were detected across the genomic sequence.We also compared the sequences of the mapping parents with the publicly available cv Nipponbare sequence.The cv Jefferson allele was identical to the Nipponbare sequence,both of which are japonica cultivars having white seeds.

Keeping in mind the possibility that annotation from the Nipponbare sequence might provide a gene model that differed from the dominant allele,we annotated the allele obtained from O.ru?pogon and compared it with the gene model available at TIGR(/tdb/e2k1/osa1).In the Nipponbare annotation,the39end of exon5and the59end of exon6were truncated relative to the O.ru?pogon gene model,predicting an mRNA in Nipponbare that was513bp shorter than the mRNA predicted from the O.ru?pogon annotation(Figure3C).To con?rm the accuracy of the different gene models,we ampli?ed a segment of cDNA from both O.ru?pogon and cv Jefferson within the only region in which the gene models differed.The cDNA amplicons were both400bp,the size expected from the O.ru?pogon annotation(Figure3A).Sequencing of this amplicon from O.ru?pogon con?rmed the splice sites predicted from the O.ru?pogon annotation.When the polymorphisms between cv Jefferson and O.ru?pogon were aligned with the new gene model,10of the sequence polymorphisms fell within the coding sequence,and5of those are expected to affect the protein sequence(Figure4).

To help identify which of the sequence polymorphisms be-tween the parents was responsible for the altered function of the gene,we also sequenced the bHLH locus in H75,an Rc mutant stock belonging to the japonica subspecies(Figure1A).H75,like O.ru?pogon,carries a functional allele,but it is much more closely related to cv Jefferson than to O.ru?pogon.Thus,a sequence comparison between H75and cv Jefferson was ex-pected to help eliminate some of the nonfunctional polymor-phisms detected between the parents in the bHLH gene.We found that the coding sequence of the bHLH allele in H75was identical to the cv Jefferson sequence except for a14-bp indel in exon6(Figure4).This14-bp sequence was present in the H75 stock as well as in O.ru?pogon,but it was deleted in cv Jefferson and cv Nipponbare.The deletion induces a frame shift in the sequence,resulting in two premature stop codons before the end of exon6.The stop codons truncate the protein before the bHLH domain.Given that this deletion was the only differ-ence between the alleles of LOC_Os07g11020.1in the H75 mutant stock(pigmented seeds)and the japonica cultivars cv Jefferson and cv Nipponbare(white seeds),that its location in exon6is consistent with the recombinational data,and that it would have a clear and important impact on gene function,we conclude that the14-bp deletion is the only apparent reason

for Figure3.Expression Analysis of Rc.

(A)Transcripts of Rc and actin detected by RT-PCR in leaves,panicles before fertilization,pericarp from grains in the milk or dough stage of ?lling,and pericarp from mature seeds from both cv Jefferson(J;white seeds)and O.ru?pogon(R;red seeds).

(B)Short transcripts of Rc detected by RT-PCR from the milk and dough stages of?lling from cv Jefferson(J)and O.ru?pogon(R)run out on polyacrylamide.

(C)Gene models from TIGR version3using the cv Nipponbare sequence and FgenesH prediction using the O.ru?pogon sequence.The regions of mRNA ampli?ed are indicated by horizontal lines,the longer one used in (A)and the shorter one used in(B).The arrow indicates the location of the 14-bp deletion.

Rc Encodes bHLH Protein Red Rice287

the lack of pigment in the pericarp of cv Jefferson and cv Nipponbare seeds.

To con?rm that the bHLH protein underlying rg7.1is also Rc ,we analyzed a second mutant stock for sequence variation in the bHLH gene.The stock,Surjamkuhi,is an indica line that carries a third allele,Rc-s ,conditioning light red seed pigmentation.This genetic stock offered independent con?rmation of the identity of the Rc gene because different sequence polymorphisms in the same gene would be expected to distinguish the Rc-s ,Rc ,and rc alleles.The sequence of the bHLH gene in Surjamkuhi differed from the sequence of the japonica cultivars at many sites (as expected for varieties from different subspecies)but differed from the O.ru?pogon allele at only four sites (positions 96,660,1353,and 1833to 1844)(Figure 4).The ?rst two changes proved to be synonymous substitutions.The change at position 1353consisted of a C-to-A change in exon 6.This single-nucleotide polymorphism was independent of any change seen in previous comparisons and represented a premature stop codon before the bHLH domain,truncating the protein and rendering the effect of the remaining indel immaterial.The fact that the different alleles of Rc show sequence polymorphisms that clearly account for the observed phenotypic differences is consistent with the conclusion that the bHLH protein is the Rc gene.

Expression Pro?les of Rc and Biosynthetic Genes in White and Red Rice

To examine the timing and localization of the Rc transcript,we used RT-PCR to amplify mRNA from leaf,young panicle (before fertilization),pericarp of young seeds (at the milk or dough stage of grain ?lling),and pericarp from mature seeds.The mRNA was collected from both cv Jefferson (white seeds)and O.ru?pogon (red seeds)plants.RT-PCR showed no expression of Rc in leaf tissue,as expected for a gene associated with a seed pheno-type;however,expression was seen in several stages of panicle development (Figure 3A).Because the promoter of the bHLH gene had been eliminated as the source of polymorphism based on the recombination data,we anticipated that similar expres-sion levels of Rc would be detected in red and white seeds.Our results con?rmed this expectation and further demonstrated that the RNA transcript from cv Jefferson contained the 14-bp deletion predicted from the sequence information (Figure 3B).Phylogenetic Comparison

To explore the evolutionary origin of Rc in rice and to identify putative orthologs in other species,we compared the sequence of Rc with other,previously identi?ed bHLH transcription factors involved in anthocyanin and proanthocyanidin regulation as well as proteins with unknown effects that were recovered from BLAST using Rc as the query.The alignable portion of these sequences extended well beyond the bHLH domain (see Sup-plemental Figure 1online),indicating that homology was not restricted to a single conserved functional domain.Analyzed using maximum parsimony or Bayesian analyses,these se-quences fell into several clades (Figure 5).

The divergence between sequences of different clades is substantial,making outgroup selection and the position of the root uncertain.Among clades 1and 2,clades 4and 5,and within clade 3,further alignment was possible,strengthening our ?nd-ings that these groups of sequences are more closely related to each other.Therefore,it is likely that the root lies on one of the branches separating the three main groupings (clades 1and 2,clade 3,and clades 4and 5)from one another.

Several copies of this type of transcription factor appear to have been present in the ancestor of the monocots and eudicots,as clades 1and 2contain both monocot and eudicot sequences (Figure 5).A third copy,present in the common ancestor of maize and rice,gave rise to clade 3,which shows gene duplication within each species.The paralogs within maize are known to confer tissue speci?city of the anthocyanin pigmentation (Goff et al.,1992).Clades 4and 5contain only eudicot sequences (Figure 5).It is clear from this analysis that Rc is not closely related to the rice bHLH proteins regulating anthocyanin,because they fall in different clades (Hu et al.,1996;Sakamoto et al.,2001).These rice anthocyanin regulators are sister to the maize anthocyanin regu-lators,and they map to homologous locations on rice chromo-some 4and maize chromosomes 2and 10,respectively.The phylogenetic analysis clusters Rc with In1from maize.Rc and In1are located in homologous chromosomal regions on chromosome 7of both genomes.In1is within maize bin 7.02,and of the 29markers within 7.02that map to the rice genome,14of them hit

a

Figure 4.Coding Sequence Differences between Rc Alleles.

(A)Graphic representation of coding sequence differences in LOC_Os07g11020.1between several pairs of genotypes.The mRNA is represented by rectangles,and the beginning and end of the exons are indicated by vertical lines.Sequence changes are annotated as follows:closed circles,nonsynonymous substitution;lines,synonymous substi-tution;closed triangles,in-frame indel;open triangles,frame-shift indel;point-up triangles,deletion from O.ru?pogon or H75;point-down trian-gle,insertion into O.ru?pogon .

(B)Table showing polymorphic sites within the coding region of LOC_Os07g11020.1for several different alleles of Rc .Functional nucle-otide polymorphisms are highlighted in gray.

288The Plant Cell

3-Mb region on rice chromosome 7,surrounding Rc .The intron–exon structures of In1and Rc are similar,but not identical.Rc has seven exons,whereas In1has nine,but in both genes the bHLH domain spans an intron–exon boundary.Although the phylogeny of Rc and In1and the positions of the 14homologous genes support orthology,In1and Rc have different functions.In1is a

negative regulator of anthocyanin synthesis,which gives an intense purple color when mutated,whereas Rc is a positive regulator of proanthocyanidin synthesis,which has no color when the function is lost (Burr et al.,1996).All of the other genes on the tree whose functions have been established are positive regula-tors,suggesting that the ancestral function is positive regulation (Goff et al.,1992;Nesi et al.,2000;Spelt et al.,2000;Sakamoto et al.,2001;Bernhardt et al.,2003;Elomaa et al.,2003).

It is possible that two orthologous genes,Rc and In1,have evolved separate functions since the divergence of the common ancestor of rice and maize.To further test the hypothesis of orthology,we compared the nucleotide divergence (Ks)values between these genes and two other pairs of genes from bin 7.02and the region around Rc (see Supplemental Figure 2online).The Ks values for the Rc –In1comparison are consistent with the expected values of orthologous gene pairs from these taxa.The surrounding genes had Ks values above and below those from the Rc –In1comparison,showing that Rc and In1were not changing faster or slower than other genes in the homologous region.Given the homologous positions of these loci and Ks values that are in agreement with expected values for two of the three genes analyzed,there is no evidence that contradicts the orthologous relationship between Rc and In1.

Thus,it appears that the rice and maize bHLH genes associ-ated with pigment production in plants have evolved separate functions over time.The rice genes found in different clades have specialized,becoming part of either the proanthocyanidin or anthocyanin pathway,whereas in maize,the duplicated genes have become positive and negative regulators of the anthocya-nin pathway.

DISCUSSION

QTL analysis was used to identify the location of rg7.1,a locus for red grain,near the centromere on rice chromosome 7.A com-bination of ?ne-mapping,mutant analysis,and sequence com-parisons demonstrated that a bHLH protein corresponding to the gene LOC_Os07g11020.1was responsible for rg7.1as well as for the classically de?ned mutant alleles Rc and Rc-s .

Allelic Variation at Rc

The functional nucleotide polymorphism,a 14-bp deletion that knocked out gene function,was suf?cient to explain the change in seed color between O.ru?pogon and cv Jefferson.It remains to be seen whether independent mutations in this gene or other genes also give rise to the white phenotype in other lineages.We are currently undertaking an association study to determine the predictive power of these mutations for pericarp color in rice.When comparing the rc and Rc-s alleles,it is not immediately apparent why the 14-bp deletion that frame shifts the bHLH domain should result in no pigment production and why a premature stop codon before the bHLH domain would give an allele conditioning light red color.In petunia and maize,an1and b1mutants lacking the bHLH domain are able to promote anthocyanin synthesis,much like the Rc-s allele (Liu et al.,1998;Spelt et al.,2002).Insertions that cause a frame shift

within

Figure 5.Phylogenetic Analysis of Rc and Other bHLH Proteins.Topology derived from Bayesian analysis using the GTR þG model after 5million generations (saving 5001trees),discarding the ?rst 100trees as burnin.It was compared with a single most parsimonious tree of 3629steps found after a heuristic search using 100random addition sequence replicates holding a maximum of 100,000trees (maximum not reached).The parsimony tree differed from the Bayesian analysis.The parsimony-preferred positions of taxa are shown by arrows where they connect to other branches;for example,in the parsimony tree,JAF13and Delila are grouped together to the exclusion of MYC1.Parsimony bootstrap per-centages (from 1000pseudoreplicates)are shown above the branches,whereas posterior probabilities from the HKY model and the GTR þG model are shown,left and right,below the branches (after 100burnin trees of 5001trees were discarded).Thicker branches have >80%bootstrap and >0.95posterior probability in each analysis.The topology should be considered unrooted.Genes that have been shown to function as regulators of the anthocyanin or proanthocyanidin pathways are named;additional sequences were retrieved from BLAST searches using Rc as the query and align across more than just the bHLH domain of ;60amino acids.The pound sign indicates a known negative regulator.

Rc Encodes bHLH Protein Red Rice 289

the bHLH domain of an1produce null alleles,a parallel to rc in rice(Spelt et al.,2002).

Functional Parallels

In maize,petunia,and Arabidopsis,the bHLH proteins R/B,AN1, and TT8interact with a Myb transcriptional activator(C1,AN2, and TT2,respectively)to promote transcription of the anthocy-anin and proanthocyanidin structural genes.In rice,only Rc has been reported as necessary for the production of colored seeds, although Rd is needed for the seed color to be red.The action of Rd is not consistent with that of the Myb transcription,as a functional copy of Rd is not required for the presence of any color in the pericarp.The Rd locus may be a biosynthetic gene that, when nonfunctional,results in the accumulation of a brown proanthocyanidin precursor.The rice gene OsC1,with similarity to the maize Myb gene C1,has been cloned on rice chromosome 6(Saitoh et al.,2004).This locus is acknowledged to have a role in purple(anthocyanin)rice pigmentation but has not been shown to play a role in red(proanthocyanidin)rice pigmentation.

It is possible that,unlike the anthocyanin regulatory systems in maize,petunia,and Arabidopsis,the bHLH gene encoded by the Rc locus is suf?cient to activate the transcription of the rice structural anthocyanin genes alone.The bHLH genes do function as transcription factors in homodimers or heterodimers in animal systems,so there is no inherent reason that proteins containing this domain could not activate transcription on their own(Heim et al.,2003).In maize,the PERICARP COLOR1Myb transcription factor has evolved so that it does not require interaction with a bHLH protein to activate the transcription of genes involved in phlobaphene production(Grotewold et al.,1994).An analogous change may have occurred in rice to allow the bHLH protein to function without an interacting partner.It is more likely,however, that rice also requires an interaction with a Myb transcription factor,but if both the red and white rices used in the genetic studies contain a functional copy of the Myb locus,it would not segregate and hence would not be detected as a contributor to pericarp color.If this is the case,a plant carrying a null allele at the Myb locus and a functional Rc should have white seeds. Despite the differences in function between Rc and In1from maize,the phylogeny of bHLH genes and Ks values support an orthologous relationship.It should be noted that the expected Ks for orthologous sequences(0.65)is also within the range expected of ancient polyploid events in these taxa(Schlueter et al.,2004). Polyploidy could also have produced duplicated regions in the common ancestor of these taxa.If a paralogous region was lost in both the rice and maize lineages after divergence,then Rc rice and In1maize could be ancient paralogs but still have the Ks values we found.Regardless of the possibility of ancient paralogy,In1would still have diverged in function from the other positive regulators of anthocyanin and proanthocyanidin found in clade1. Phenotypic Associations

Red pericarp has long been used as marker for the cluster of domestication traits associated with weedy rice,including dor-mancy and shattering(Gu et al.,2005).Several studies have placed QTLs for dormancy and shattering in the pericentromeric region of chromosome7,encompassing the Rc locus.With the cloning of Rc,it is now possible to ask whether this association is the result of linkage or pleiotrophy.Given the reduced rate of recombination within the rg7.1QTL,it is logical that genes for shattering,dormancy,and pericarp color have simply hitchhiked together in a linkage block.Indeed,?ne-mapping of a rice shattering gene in this region has recently shown that this gene is tightly linked to Rc,although it occupies a different position on chromosome7(H.Ji,personal communication).It is also pos-sible that Rc acts pleiotropically,as do many of the other bHLH proteins presented in the phylogeny(Payne et al.,2000;Spelt et al.,2002;Bernhardt et al.,2003;Zhang et al.,2003).Using the recombinant lines generated in this work,we will be able to test these different hypotheses.

Rice and wheat(Triticum aestivum)are similar in that red pericarp in both species can be eliminated by one -parative mapping shows no homology between the position of the Rc gene in rice and the R gene controlling red pericarp in wheat.A reverse genetics approach also failed to locate any ESTs from wheat that map to the Rc locus,although this is not surprising,because no rice or maize ESTs have been found for this locus either.Our work con?rms that the Rc transcript only ampli?es with a high sensitivity Taq polymerase,and this sug-gests that low transcript abundance may also explain the lack of EST hits in wheat.The R locus in wheat may be orthologous to the Rd gene in rice,given their homologous positions on wheat chromosome3and rice chromosome1.Although the systems look similar phenotypically,molecular genetics analysis sug-gests that the mutations leading to white pericarp occurred at different points in the pathway.

Recombinational Analysis

The rg7.1locus was originally mapped to a7.2-Mb region that included the centromere on rice chromosome7.Given the low frequency of recombination across this region,it was not clear whether positional cloning would be feasible.This study dem-onstrates that even in regions that are recombinationally re-pressed,map-based gene isolation offers a viable approach. The Rc/rg7.1locus is an area rich in gypsy retrotransposons and other repetitive elements().Several pre-vious studies have noted signi?cant repression of recombination associated with the abundance of TEs and other repetitive sequences(Fu et al.,2002;Wu et al.,2003;Shah and Hassan, 2005).Therefore,we expected that the TEs themselves might contribute to the recombinational repression.However,?ne-mapping demonstrated that within the401-kb region analyzed in the BC2F6generation,one of the regions with a signi?cantly increased recombination rate was TE-rich.

It has been shown that recombinational break points occur most often in regions with the greatest sequence similarity and that indels(including TEs)decreased the rate of crossovers more than single-nucleotide polymorphisms(Puget et al.,2002).The TE components of varieties may be different,and the lack of similarity would be one explanation for the low recombination in TE-rich regions.A recent study in humans showed that the retrotranspo-sons THE1A and THEA1B are overrepresented in recombinational

290The Plant Cell

hot spots and that the motif CCTCCCT,found associated with the retrotransposons,has a role in hot spot determination(Myers et al., 2005).In our study,one of the TEs in a region with enhanced recombination near Rc contains a CCTCCCT motif.This offers an alternative explanation for the signi?cant increase in recombina-tion in this particular TE-rich region.

Implications

The cloning of Rc will make possible new methods of?ghting weedy rice infestations in rice paddies.Red rice is a noxious weed that is currently responsible for losses of as much as $50million per year in the United States(Gealy et al.,2002).It is a perfect mimic of elite varieties,as the red pericarp is not visible until after harvest,when the grains are dehulled.Furthermore,the close association between red pericarp,seed shattering,and dormancy allows it to persist in?elds for years despite vigorous attempts to remove it.The fact that the pericarp is maternal tissue,so that its color is dependent on the maternal genotype, means that seeds pollinated by red rice can be white(if the maternal plant carries the rc allele),but plants grown from these seeds will produce red seeds.

An immediate application of the work presented here involves the use of perfect markers that speci?cally target the14-bp functional nucleotide polymorphism within the bHLH gene to screen for red rice contamination within certi?ed seed lots.This will also facilitate the use of genes derived from crosses with wild relatives by allowing breeders to conclusively select against progeny carrying Rc,and to do so before the plants set seed. METHODS

QTL Population Development and QTL Detection

A BC2F2population was constructed for QTL mapping using Oryza sativa subsp tropical japonica cv Jefferson as the recurrent parent and a wild accession of Oryza ru?pogon(IRGC-105491from Malaysia)as the donor parent(Thomson et al.,2003).QTL detection was followed as described by Thomson et al.(2003).

Fine-Mapping of rg7.1

Eighteen BC2F2families with red grain but with low levels of dormancy and shattering were used to?ne-map the QTL.These families represent a subset of the red-grained phenotypes in the BC2F2population.These segregating families were grown in50-mm-wide3178-mm-deep plastic pots in the Guterman Greenhouse at Cornell University.DNA was extracted using the Matrix Mill method(Paris and Carter,2000).The microsatellite and indel markers were ampli?ed using standard PCR protocols,run on4%polyacrylamide electrophoresis gels,and silver-stained as described(Panaud et al.,1995).Seeds were harvested,and10 to15seeds/plants were dehulled to determine seed color.Color was scored as either present or absent.In each generation,we determined which segments of DNA from the red donor parent,O.ru?pogon,were present in all red-seeded progeny and discounted the O.ru?pogon segments that appeared in white-seeded progeny as possible gene positions.Only plants heterozygous for the region containing rg7.1were planted for the next generation of screening.A total of5922individuals from BC2F3to BC2F6were genotyped.Molecular Marker Development

The required density of molecular markers in the target region was achieved using previously published SSRs(McCouch et al.,2002)as well as SSR and indel markers developed as part of this study.New markers were designed from the publicly available rice genome sequence(http:// /tigr-scripts/osa1_web/gbrowse/rice;http://143.48.220.116/ genome_browser/index.html)using the SSRIT tool(http://143.48.220. 116/db/searches/ssrtool).Indel markers were designed by sequencing areas from both cv Jefferson and O.ru?pogon and aligning the sequences using the SeqMan program of DNAstar(GeneCodes)to identify indels. Primer sequences,map positions,and ampli?ed lengths of the newly developed SSRs and indel markers used in this study are listed in Sup-plemental Table1online.

Recombination Rate Statistics

The recombination rate for each interval was compared with the average using likelihood ratio test statistics and P values for the test that compares the two-parameter model in which the fragment has its own unique recombination rate(while everything else is uniform)with the model in which everything is uniform.The likelihood of each recombination rate¼e l l xi/x i!where x i¼the number of recombinants in interval i,l¼r(length of sequence)(number of plants),and r is the per nucleotide recombination rate and is estimated as(total number of recombinants)/(total length of region)/(number of plants).The P values were corrected for multiple tests using a Bonferroni correction.The RM21177to RM21194interval was signi?cantly lower than the average,even after the recombination rates from the two hot spots with P<0.001were excluded from the average. Sequence Analysis of Red and White Cultivars

Overlapping primers between700and900bp were designed to cover the HLH gene and were used to amplify DNA with Pfu polymerase(Invitro-gen).Ampli?ed products were sequenced at the Cornell Biotechnology Resource Center.

RT-PCR

mRNA was collected from cv Jefferson and O.ru?pogon panicles from the following stages and tissues:mature leaves,spikelets before polli-nation,dehulled seeds from the milk/dough stage of seed?lling minus the starchy endosperm,and pericarp and seed coat scraped from the hardened endosperm of mature dried seeds.Total RNA was extracted with the RNAeasy miniplant RNA extraction kit(Qiagen).Total RNA(1m g) was converted into cDNA with reverse transcriptase(Invitrogen),accord-ing to the manufacturer’s instructions.As a control,water was used in place of reverse transcriptase for the reaction.The reaction was diluted threefold,and2m L of cDNA was used for ampli?cation.A total of10m L of PCR products was loaded on1%agarose gels.Primers for RT-PCR were designed to span introns.BLAST searches were used to ensure that primers were speci?c to the candidate gene of interest.The primers used were as follows:actin F,59-CGTCCTCTCTCTGTATGCCAG-39;actin R, 59-CTGGTACCCTCATCAGGCAT-39;Rc F,59-GCCTTGTCACTCTTG-GCATT-39;Rc R,59-GGTTGGCACTGAAATCACCT-39;Rc short F, 59-CAGGCACCACACAGAGAATG-39;Rc short R,59-CTCCTCTCTTT-CAGCACATGG-39.

Sequence Alignment and Tree Building

DNA sequences were aligned in BioEdit(Hall,1999)with the assistance of ClustalW(Thompson et al.,1994)and bl2seq(Tatusova and Madden,

Rc Encodes bHLH Protein Red Rice291

1999)to identify similar regions,with extensive manual adjustment. Alignment was undertaken to initially preserve the reading frame of each sequence.Some gaps were later introduced that disrupted small sections of the reading frame to minimize the total number of events (substitutions,insertions,or deletions)required to transform one se-quence to another.Only some regions of the sequences could be con?dently aligned across all taxa,including the bHLH domain(;1kb). Further alignment was accomplished among sequences within the three main clades found in our analyses,with gaps for the remaining sequences (;500bp).Gaps were treated as missing in all analyses.Indels were not coded as additional characters.

Analyses

The aligned matrix was examined for the presence of secondary signal(s) using reverse successive weighting,implemented in RSW1.1a(Trueman, 1998).Using a parsimony bootstrap cutoff of70%and1000fast bootstrap replicates,no evidence of secondary signal was found.Further analyses were conducted with equal character weighting using parsimony imple-mented in PAUP*(Swofford,1998)as well as Bayesian analysis using HKY and GTRþG models implemented in Mr Bayes(Huelsenbeck and Ronquist,2001)version3.1.1to examine the sensitivity of the resulting phylogenetic inference to some model and method variation.Of1449 aligned positions,810(55%)were parsimony-informative.A single most parsimonious tree of3629steps was found after a heuristic search using 100random addition sequence replicates holding a maximum of100,000 trees(maximum not reached);Bayesian analyses for both models used10 chains and were run for5million generations,saving a tree every1000 generations.Two replicate runs were compared with check convergence using the likelihood versus generation plot.Full mixing was evident from almost the?rst few generations,so an arbitrary100burnin trees were discarded before producing the consensus topologies and clade posterior probabilities.The parsimony tree differed slightly from the Bayesian majority rule tree(Figure5).The parsimony-preferred positions of taxa are shown by arrows where they connect to other branches. Synonymous changes per synonymous site(Ks)were calculated for Rc rice and In1maize(Zea mays)sequences along with sequences from two ?anking genes from both species,No Apical Meristem putative protein and putative cellulose synthase sequences.We used the method of Yang and Nielsen(2000)implemented in PAML(Yang,2000;Yang and Nielsen, 2000)to test whether these values were consistent with that expected for orthologous sequences,around Ks¼0.65,assuming a synonymous substitution rate of0.65310ÿ9(Gaut et al.,1996)and the age of divergence of rice and maize at50million years ago(Gaut,2002).Two approaches were considered when deciding how different Ks values could be from the expected values and not be signi?cantly different.In the ?rst approach,we compared two standard errors above and below the estimated Ks for each gene with the expected value of0.65.This represents an approximation of the95%con?dence interval around each estimate.The other approach we used was to treat the expected value as the mean of a distribution of Ks values,and therefore an estimate for any one pair of genes.Extending a similar approach that has been used in comparisons of genes duplicated by polyploidy(Zhang et al., 2003),we might expect the variation for90%of genes duplicated by the same event(here speciation)to show2.6-fold variation in Ks.Therefore,a range of0.361to0.939around0.65can be expected for most genes. Accession Numbers

Sequence data for the genomic sequence of Rc can be found in the GenBank/EMBL data libraries under the following accession numbers: H75,DQ204735;cv Jefferson,DQ204736;O.ru?pogon,DQ204737; Surjamkuhi,DQ204738.The cDNA fragment ampli?ed from O.ru?pogon has accession number DQ315482.Supplemental Data

The following materials are available in the online version of this article.

Supplemental Table1.Primers Developed for Fine-Mapping.

Supplemental Figure1.Sequence Alignments Used in Phylogenetic Analysis.

Supplemental Figure2.Ks Ranges for Rc–In1Surrounding Gene Pairs.

ACKNOWLEDGMENTS

We thank W.De Jong and J.J.Doyle for critical reading of the manuscript and L.Swales for administrative assistance.The Rc mutant stocks were provided by H.J.Koh.We are grateful to Scott Williamson for statistical consultation about hot spot analysis and to Dave Gealey for helpful discussions and for providing information about?eld problems associ-ated with weedy red rice.This material is based upon work supported by National Science Foundation Grant0110004.B.E.P.acknowledges support from National Science Foundation Grant0321664.

Received October6,2005;revised December13,2005;accepted December19,2005;published January6,2006.

REFERENCES

Baudry,A.,Heim,M.A.,Dubreucq,B.,Caboche,M.,Weisshaar,B., and Lepiniec,L.(2004).TT2,TT8,and TTG1synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana.Plant J.39,366–380.

Bernhardt,C.,Lee,M.M.,Gonzalez,A.,Zhang,F.,Lloyd,A.,and Schiefelbein,J.(2003).The bHLH genes GLABRA3(GL3)and EN-HANCER OF GLABRA3(EGL3)specify epidermal cell fate in the Arabidopsis root.Development130,6431–6439.

Burr,F.A.,Burr,B.,Schef?er,B.E.,Blewitt,M.,Wienand,U.,and Matz,E.C.(1996).The maize Repressor-like Gene intensi?er1shares homology with the r1/b1multigene family of transcription factors and exhibits missplicing.Plant Cell8,1249–1259.

Carey,C.C.,Strahle,J.T.,Selinger,D.A.,and Chandler,V.L.(2004). Mutations in the pale aleurone color1regulatory gene of the Zea mays anthocyanin pathway have distinct phenotypes relative to the func-tionally similar TRANSPARENT TESTA GLABRA1gene in Arabidopsis thaliana.Plant Cell16,450–464.

Carmona, A.,Borgudd,L.,Borges,G.,and Levy-Benshimol, A. (1996).Effect of black bean tannins on in vitro carbohydrate digestion and absorption.J.Nutr.Biochem.7,445–450.

de Vetten,N.,Quattrocchio,F.,Mol,J.,and Koes,R.(1997).The an11 locus controlling?ower pigmentation in petunia encodes a novel WD-repeat protein conserved in yeast,plants,and animals.Genes Dev. 11,1422–1434.

Eggum,B.,Alabata,E.,and Juliano,B.(1981).Protein utilization of pigmented and nonpigmented brown and milled rice by rats.Qual. Plant Plant Foods Hum.Nutr.31,175–179.

Elomaa,P.,Uimari,A.,Mehto,M.,Albert,V.A.,Laitinen,R.A.E.,and Teeri,T.H.(2003).Activation of anthocyanin biosynthesis in Gerbera hybrida(Asteraceae)suggests conserved protein-protein and protein-promoter interactions between the anciently diverged monocots and eudicots.Plant Physiol.133,1831–1842.

Fu,H.,Zheng,Z.,and Dooner,H.K.(2002).Recombination rates between adjacent genic and retrotransposon regions in maize vary by 2orders of A99,1082–1087.

292The Plant Cell

Gaut, B.S.(2002).Evolutionary dynamics of grass genomes.New Phytol.154,15–28.

Gaut, B.S.,Morton, B.R.,McCaig, B.M.,and Clegg,M.T.(1996). Substitution rate comparisons between grasses and palms:Synony-mous rate differences in the nuclear gene Adh parallel rate differences at the plastid gene A93,10274–10279. Gealy,D.R.,Tai,T.H.,and Sneller,C.H.(2002).Identi?cation of red rice,rice,and hybrid populations using microsatellite markers.Weed Sci.50,333–339.

Glahn,R.,Cheng,Z.,and Welch,R.(2002).Comparison of iron bioavailability from15rice genotypes:Studies using an in vitro digestion/caco-2cell culture model.J.Agric.Food Chem.50,3586–3591.

Goff,S.,Cone,K.,and Chandler,V.(1992).Functional analysis of the transcriptional activator encoded by the maize B gene:Evidence for a direct functional interaction between two classes of regulatory pro-teins.Genes Dev.6,864–875.

Grotewold,E.,Drummond,B.,Bowen,B.,and Peterson,T.(1994). The myb-homologous P gene controls phlobaphene pigmentation in maize?oral organs by directly activating a?avonoid biosynthetic gene subset.Cell76,543–553.

Gu,X.-Y.,Kianian,S.F.,Hareland,G.A.,Hoffer,B.L.,and Foley,M.E. (2005).Genetic analysis of adaptive syndromes interrelated with seed dormancy in weedy rice(Oryza sativa).Theor.Appl.Genet.110,1108–1118.

Hall,T.A.(1999).BioEdit:A user-friendly biological sequence alignment editor and analysis program for Windows95/98/NT.Nucleic Acids Symp.Ser.41,95–98.

Hartmann,U.,Sagasser,M.,Mehrtens, F.,Stracke,R.,and Weisshaar,B.(2005).Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB,BZIP,and BHLH factors control light-responsive and tissue-speci?c activation of phenylpro-panoid biosynthesis genes.Plant Mol.Biol.57,155–171.

Heim,M.A.,Jakoby,M.,Werber,M.,Martin,C.,Weisshaar,B.,and Bailey,P.C.(2003).The basic helix-loop-helix transcription factor family in plants:A genome-wide study of protein structure and functional diversity.Mol.Biol.Evol.20,735–747.

Hernandez,J.M.,Heine,G.F.,Irani,N.G.,Feller, A.,Kim,M.-G., Matulnik,T.,Chandler,V.L.,and Grotewold,E.(2004).Different mechanisms participate in the R-dependent activity of the R2R3MYB transcription factor C1.J.Biol.Chem.279,48205–48213.

Hu,J.,Beth,A.,and Wessler,S.R.(1996).Isolation and characteriza-tion of rice R genes:Evidence for distinct evolutionary paths in rice and maize.Genetics142,1021–1031.

Huelsenbeck,J.P.,and Ronquist, F.(2001).Mr Bayes:Bayesian inference of phylogeny.Bioinformatics17,754–755.

Ithal,N.,and Reddy, A.R.(2004).Rice?avonoid pathway genes, OsDfr and OsAns,are induced by dehydration,high salt and ABA, and contain stress responsive promoter elements that interact with the transcription activator,OsC1-MYB.Plant Sci.166,1505–1513.

Kato,S.,and Ishikawa,J.(1921).On the inheritance of the pigment of red rice.Jpn.J.Genet.1,1–7.

Kinoshita,T.(1998).Linkage mapping using mutant genes in rice.Rice Genet.Newsl.15,13–74.

Kubo,H.,Peeters, A.J.M.,Aarts,M.G.M.,Pereira, A.,and Koornneef,M.(1999).ANTHOCYANINLESS2,a homeobox gene affecting anthocyanin distribution and root development in Arabi-dopsis.Plant Cell11,1217–1226.

Ling,W.H.,Cheng,Q.X.,Ma,J.,and Wang,T.(2001).Red and black rice decrease atherosclerotic plaque formation and increase antiox-idant status in rabbits.J.Nutr.131,1421–1426.

Liu,Y.,Wang,L.,Kermicle,J.,and Wessler,S.R.(1998).Molecular

consequences of Ds insertion into and excision from the helix-loop-helix domain of the maize R gene.Genetics150,1639–1648. McCouch,S.R.,et al.(2002).Development and mapping of2240new SSR markers for rice(Oryza sativa L.).DNA Res.9,199–207. Myers,S.,Bottolo,L.,Freeman,C.,McVean,G.,and Donnelly,P. (2005).A?ne-scale map of recombination rates and hotspots across the human genome.Science310,321–324.

Nesi,N.,Clarisse,J.,Debeaujon,I.,Caboche,M.,and Lepinec,L. (2001).The Arabidopsis TT2gene encodes an R2R3MYB domain protein that acts as a key determinant for proanthocyanidin accumu-lation in developing seed.Plant Cell13,2099–2114.

Nesi,N.,Debeaujon,I.,Jond,C.,Pelletier,G.,Caboche,M.,and Lepiniec,L.(2000).The TT8gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques.Plant Cell12,1863–1878.

Oki,T.,Masuda,M.,Kobayashi,M.,Nishiba,Y.,Furuta,S.,Suda,I., and Sato,T.(2002).Polymeric procyanidins as radical-scavenging components in red-hulled rice.J.Agric.Food Chem.50,7524–7529. Panaud,O.,Chen,X.,and McCouch,S.R.(1995).Frequency of microsatellite sequences in rice(Oryza sativa L.).Genome38,1170–1176.

Paris,M.,and Carter,M.(2000).Cereal DNA:A rapid high-throughput extraction method for marker assisted selection.Plant Mol.Biol.Rep. 18,357–360.

Payne,C.T.,Zhang,F.,and Lloyd,A.M.(2000).GL3encodes a bHLH protein that regulates trichome development in Arabidopsis through interaction with GL1and TTG1.Genetics156,1349–1362.

Puget,N.,Gad,S.,Perrin-Vidoz,L.,Sinilnikova,O.M.,Stoppa-Lyonnet, D.,Lenoir,G.M.,and Mazoyer,S.(2002).Distinct BRCA1rearrangements involving the BRCA1pseudogene suggest the existence of a recombination hot spot.Am.J.Hum.Genet.70, 858–865.

Sagasser,M.,Lu,G.-H.,Hahlbrock,K.,and Weisshaar,B.(2002).A. thaliana TRANSPARENT TESTA1is involved in seed coat develop-ment and de?nes the WIP subfamily of plant zinc?nger proteins. Genes Dev.16,138–149.

Saitoh,K.,Onishi,K.,Mikami,I.,Thidar,K.,and Sano,Y.(2004). Allelic diversi?cation at the C(OsC1)locus of wild and cultivated rice: Nucleotide changes associated with phenotypes.Genetics168,997–1007.

Sakamoto,W.,Ohmori,T.,Kageyama,K.,Miyzaki,C.,Saito,A., Murata,M.,Noda,K.,and Maekawa,M.(2001).The purple leaf(pl) locus of rice:The Pl w allele has a complex organization and includes two genes encoding basic helix-loop-helix proteins involved in an-thocyanin biosynthesis.Plant Cell Physiol.42,982–991. Schlueter,J.A.,Dixon,P.,Granger,C.,Grant,D.,Clark,L.,Doyle, J.J.,and Shoemaker,R.C.(2004).Mining the EST databases to resolve evolutionary events in major crop species.Genome47, 868–876.

Septiningsih, E.M.,Trijatmiko,K.R.,Moeljopawiro,S.,and McCouch,S.R.(2003).Identi?cation of quantitative trait loci for grain quality in an advanced backcross population derived from the Oryza sativa variety IR64and the wild relative O.ru?pogon.Theor.Appl. Genet.107,1433–1441.

Shah,M.M.,and Hassan,A.(2005).Distribution of genes and recom-bination on wheat homoeologous group6chromosomes:A synthesis of available information.Mol.Breed.15,45–53.

Shirley,B.(1998).Flavonoids in seeds and grains:Physiological func-tion,agronomic importance and the genetics of biosynthesis.Seed Sci.Res.8,415–422.

Sompornpailin,K.,Makita,Y.,Yamazaki,M.,and Saito,K.(2002).

A WD-repeat-containing putative regulatory protein in anthocyanin biosynthesis in Perilla frutescens.Plant Mol.Biol.50,485–495.

Rc Encodes bHLH Protein Red Rice293

Spelt,C.,Quattrocchio,F.,Mol,J.,and Koes,R.(2002).ANTHOCY-ANIN1of petunia controls pigment synthesis,vacuolar pH,and seed coat development by genetically distinct mechanisms.Plant Cell14, 2121–2135.

Spelt,C.,Quattrocchio,F.,Mol,J.N.M.,and Koes,R.(2000).antho-cyanin1of petunia encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes.Plant Cell12,1619–1632.

Swofford,D.L.(1998).PAUP*:Phylogenetic Analysis Using Parsimony (*and Other Methods),Version 4.0b10.(Sunderland,MA:Sinauer Associates).

Tatusova,T.A.,and Madden,T.L.(1999).BLAST2sequences—A new tool for comparing protein and nucleotide sequences.FEMS Microbiol.Lett.174,247–250.

Thompson,J.D.,Higgins,D.G.,and Gibson,T.J.(1994).CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting,position-speci?c gap penalties and weight matrix choice.Nucleic Acids Res.22,4673–4680. Thomson,M.J.,Tai,T.H.,McClung,A.M.,Lai,X.-H.,Hinga,M.E., Lobos,K.B.,Xu,Y.,Martinez,C.P.,and McCouch,S.R.(2003). Mapping quantitative trait loci for yield,yield components and mor-phological traits in an advanced backcross population between Oryza ru?pogon and the Oryza sativa cultivar Jefferson.Theor.Appl.Genet. 107,479–493.Trueman,J.W.H.(1998).Reverse successive weighting.Syst.Biol.47, 733–737.

Vaughan,L.K.,Ottis, B.V.,Prazak-Havey, A.M.,Bormans, C.A., Sneller,C.,Chandler,J.M.,and Park,W.D.(2001).Is all red rice found in commercial rice really Oryza sativa?Weed Sci.49,468–476. Walker, E.,Eggleston,W.B.,Demopulos, D.,Kermicle,J.,and Dellaporta,S.L.(1997).Insertions of a novel class of transposable elements with a strong target site preference at the r locus of maize. Genetics146,681–693.

Winkel-Shirley,B.(2001).Flavonoid biosynthesis.A colorful model for genetics,biochemistry,cell biology,and biotechnology.Plant Physiol. 126,485–493.

Wu,J.,et al.(2003).Physical maps and recombination frequency of six rice chromosomes.Plant J.36,720–730.

Yang,Z.(2000).Phylogenetic Analysis by Maximum Likelihood(PAML), Version3.0.(London:University College).

Yang,Z.,and Nielsen,R.(2000).Estimating synonymous and non-synonymous substitution rates under realistic evolutionary models. Mol.Biol.Evol.17,32–43.

Zhang,F.,Gonzalez,A.,Zhao,M.,Payne,C.T.,and Lloyd,A.(2003).A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis.Development130,4859–4869.

Zhao,Q.,et al.(2002).A?ne physical map of the rice chromosome4. Genome Res.12,817–823.

294The Plant Cell

Sweeney et al.

Page 1 Supplemental Figure 1.

1-600

Sequence alignments used in phylogenetic analysis.

Sweeney et al.

Page 2 Supplemental Figure 1.

600-1200

Sequence alignments used in phylogenetic analysis.

Sweeney et al.

Page 3

Supplemental Figure 1.

1200-1449

Sequence alignments used in phylogenetic analysis.

Sweeney et al.

Supplemental Figure 2.

Ks and two times standard error bars for pairwise rice-maize

comparisons for the following loci: NAM (left), Rc rice - In1

maize (middle) and Cellulose Synthase (right). The solid line

indicates c. 0.65 Ks, which is the expected value for orthologous loci for these species.

Supplemental Table 1. Primers Developed for Fine Mapping

Locus

name Forward primer Reverse primer Bp position

on TIGR assembly, v3 Allele size Nipponbare RID6 cgtcgaaaacgacatgtatga

gttggggatggaagaattga 6,060,924 - 6,061,098 175RID7 tcaacgtttgaccgttcatc

cacatgtgtcgacaaaggaaa 6,060,277 - 6,060,976 700RID8 aactcttagtggggtcttagtcct

caaagggagtgatacctacacatt 6,108,072 - 6,107,956 117RID9 atcatatctggggtcggatagaa

gtacatgcagtaccgcgaca 6,747,632 - 6,747,880 249RID10 aggggcagttttcagtcaga ctattgccccctgtggtcta

6,411,490 - 6,412,048 559RID11 ggagtggttcttcgacagtaaaa

ggagacgcagttgaagatcc 6,133,359 - 6,133,934 576RID12 tacaggggagcagaaacacc

aaaggtaccaaagatcgcagaa 6,066,321 - 6,066,473 153RID13 acctacgacacgatgcacag

atgccatgcgatcacaacta 6,061,299 - 6,061,598 300RID14 tgcatgcttaattacgtggtc tgggacggagggagtagtag

6,068,728 - 6,068,850 123RID15 acgcaaggcttagctgtgat aaatgaaagcgatgcgagtc 6,083,097 - 110

6,083,206

RID16 cctagctagcatggaatcacatc cattctagacccccatggaa 6,091,337 -

6,091,528 195

RID17 gggtcatttcgttttaaggaatc cattggcacagtaccacgag 6,097,562 -

6,097,787 196

RID18 ccaaaggcaactagaagtgc tgtcatgcaaaccagtgttaat 6,101,900 -

6,102,086 196

RM651 caggtgtccatcatcgagag aggatcataacgacgacctt 6,067,381 -

6,067,574 194

RM652 gccaaggtcgtcgttatgat ccaaccaattcacccacac 6,067,552 -

6,067,778 227

RM653 tactcccccattcctctcct agccctgctcactgttcatt 6,139,018 -

6,138,808 211

RM21177 ggagggttgccgatatatga atgcagcgggagtttttatg 5,728,266 -

5,728,494 229

RM21194 tatggctacacgcctacacg gaagcgtgggatgtttgttt 6,034,075 -

6,034,276 202

RM21197 ttgcaacattttagtcggtgag ccatacatggcctctccttg 6,064,410 -

6,064,645 236

本文来源：https://www.bwwdw.com/article/77b1.html